PDA

View Full Version : Is This The Long Awaited Pandemic?



Bruce Clemens
04-25-2009, 12:11 AM
From: http://online.wsj.com/article/SB124061694466055035.html

APRIL 24, 2009, 7:52 P.M. ET Scientists Fear People Spread New Swine Flu



By GAUTAM NAIK (http://online.wsj.com/search/search_center.html?KEYWORDS=GAUTAM+NAIK&ARTICLESEARCHQUERY_PARSER=bylineAND)

Scientists are baffled and deeply worried by the latest outbreak of swine flu for two reasons: It appears to combine bird, swine and human viruses in a way that hasn't been seen before, and it is spreading from person to person.
Although swine flu has been known to sporadically infect people, it has usually occurred in rare cases in which the virus jumps from swine to humans who are directly exposed to the animals, such as pig farmers. The virus that has surfaced in Mexico -- and apparently California and Texas -- is known as A/H1N1, a strain that hasn't been previously detected in pigs or humans.
According to the Centers for Disease Control and Prevention in Atlanta, there have been some documented cases of a person-to-person jump. In 1988, for example, an apparent swine-flu infection in the U.S. was transmitted from a patient to health-care workers who were in close contact with the person.
However, neither of the two California children diagnosed with the illness this spring had close contact with pigs. This, the CDC said, "increases the possibility that human-to-human transmission of this new influenza has occurred."
Not all pandemics are lethal, and it is far from clear whether the current swine flu infecting people could be the beginnings of a global outbreak. However, the World Health Organization is worried enough that it has alerted an expert panel that can recommend whether to raise the alert level for a global pandemic...


I have been waiting for this "pandemic" for years. I think it's the next thing in line as the NWO ratchets up the takeover of your life and mine.

Global warming, global terrorism, global economic meltdown, global pandemic...could I have picked a worse time to be a freedom loving (mine and yours both) individual? So the terror continues...may the Government save us.

Bruce Clemens
04-25-2009, 12:19 AM
Just saw this here:
http://tvnz.co.nz/world-news/schwarzenegger-readies-state-flu-spread-2673798
(http://tvnz.co.nz/world-news/schwarzenegger-readies-state-flu-spread-2673798)


California has made a "rigorous and thorough" response to a new strain of flu that has killed up to 60 people in Mexico and infected eight in the United States, Governor Arnold Schwarzenegger said on Friday.
California, home to six of the US cases, was coordinating with federal and international health experts on its plan, which includes surveillance of patients with flu-like illness,Schwarzenegger said in a statement.
Other steps the state has taken include requesting extra flu experts from the US Centers for Disease Control and expanding lab testing and veterinary activities, he said.
California has also activated its Joint Emergency Operations Center with the Department of Public Health and been in communication with officials in Mexico.


OK. So now if you are a Californian and have flu-like symptoms, you are going to be surveilled by the government.


Any thoughts as to where this strain came from?

Bruce Clemens
04-25-2009, 01:41 AM
Mexico City launches massive vaccination campaign against swine flu


www.chinaview.cn (http://www.chinaview.cn/index.htm) http://imgs.xinhuanet.com/icon/2006english/2007korea/space.gif 2009-04-24 23:06:06 http://imgs.xinhuanet.com/icon/2006english/xiao.jpg (http://news.xinhuanet.com/english/2009-04/24/content_11252336.htm#)http://imgs.xinhuanet.com/icon/2006english/2007korea/space.gif http://imgs.xinhuanet.com/icon/2006english/da.jpg (http://news.xinhuanet.com/english/2009-04/24/content_11252336.htm#)http://imgs.xinhuanet.com/icon/2006english/2007korea/space.gif Print (http://javascript%3Cb%3E%3C/b%3E:doPrint%28%29;)
MEXICO CITY, April 24 (Xinhua) -- The government of Mexico City is launching a massive vaccination campaign throughout the city
The Mexican government confirmed on Friday the outbreak of the swine flu, and warned people to avoid crowds.
"It's a virus which mutated from pigs and transmitted to some human," Health Minister Jose Angel Cordova told Televisa television.
Health officials are now investigating the possible deaths and infections caused by the virus. Virus samples have been sent to laboratories in Canada for testing, they said.
The government also decided to close all schools in Mexico City and the center of the country to avoid spreading of the virus.
The World Health Organization, which has identified swine influenza as a potential source of a human flu pandemic, has also activated its global epidemic operations center. against swine flu, which has possibly killed 45 people and infected 943 nationwide.

OK...I'm no expert, but I recall seeing information that every year flu vaccine is a hit-and-miss proposition. The CDC and other flu "experts" monitor the strains that develop (primarily in China) early in the season, and produce vaccine that is targeted for that strain. If they are right, their vaccine works. But often the strain mutates before getting to the Western world, and they are caught short with stockpiles of vaccine that aren't effective. If this is the case (please chime in, medical experts.) how can Mexico actually have an effective vaccine for a flu strain that has only been seen for a few days?

Update:
Here's some information addressing the question I raised above.
(from http://blogs.wsj.com/health/2009/04/24/swine-flu-in-the-us-and-mexico/)

Can the swine flu be treated with antiviral drugs?
Like some garden-variety flu, this swine flu is resistant to two drugs known as amantadine and rimantadine. Earlier this week, the CDC reported that the swine flu was being tested for susceptibility to Tamiflu and Relenza, two newer drugs.
Does the flu vaccine protect against the swine flu?
The CDC reported earlier this week that the seasonal flu vaccine might not provide protection against the flu. The agency says it has created a seed vaccine specifically tailored to this swine flu. That could be used to manufacture a targeted vaccine if officials deem it necessary to do so.

Magda Hassan
04-25-2009, 03:40 AM
It is only a matter of time before there is an influenza outbreak whether by design or naturally occurring circumstances. What is known is that Donald Rumsfeld and others will be making a packet as they have shares in the pharmaceutical compnay, Gilead, that makes Tamiflu which is said to be the most effective drug against this strain. Though its rate of effectiveness is still quite low actually. IIRC

http://www.snopes.com/politics/medical/tamiflu.asp

Peter Lemkin
04-25-2009, 05:27 AM
Before I saw this thread, I just started another one with the story below. As an environmental scientist I can confirm this is very worrying and even if these two incidents [strange the timing of two different at the same time] peter-out it is something to really worry about! Unlike 1913 we move around more all over the globe and there are 3x as many people crowded onto the planet. 10-25% of the global population could easily die in a pandemic of this type - maybe more. If and when it is a bioweapon you can be sure those that manufactured it and their friends will all have the antidote and the rest will not. This one is very suspicious, as it has DNA portions from pigs, birds and humans all together. It could happen naturally, but the odds are slim.

Whether a natural event or an antropogenic [bioweapon] one, this is something very dangerous to watch for now and in the future. If a pandemic of one of these two spread, it could easily kill 10-25% of the world's population within a few months.


MEXICO CITY A unique strain of swine flu is the suspected killer of dozens of people in Mexico, where authorities closed schools, museums, libraries and theaters in the capital on Friday to try to contain an outbreak that has spurred concerns of a global flu epidemic.

The worrisome new virus which combines genetic material from pigs, birds and humans in a way researchers have not seen before also sickened at least eight people in Texas and California, though there have been no deaths in the U.S.

"We are very, very concerned," World Health Organization spokesman Thomas Abraham said. "We have what appears to be a novel virus and it has spread from human to human ... It's all hands on deck at the moment."

The outbreak caused alarm in Mexico, where more than 1,000 people have been sickened. Residents of the capital donned surgical masks and authorities ordered the most sweeping shutdown of public gathering places in a quarter century. President Felipe Calderon met with his Cabinet Friday to coordinate Mexico's response.

The WHO was convening an expert panel to consider whether to raise the pandemic alert level or issue travel advisories.

It might already be too late to contain the outbreak, a prominent U.S. pandemic flu expert said late Friday.

Given how quickly flu can spread around the globe, if these are the first signs of a pandemic, then there are probably cases incubating around the world already, said Dr. Michael Osterholm at the University of Minnesota.

In Mexico City, "literally hundreds and thousands of travelers come in and out every day," Osterholm said. "You'd have to believe there's been more unrecognized transmission that's occurred."

There is no vaccine that specifically protects against swine flu, and it was unclear how much protection current human flu vaccines might offer. A "seed stock" genetically matched to the new swine flu virus has been created by the U.S. Centers for Disease Control, said Dr. Richard Besser, the agency's acting director. If the government decides vaccine production is necessary, manufacturers would need that stock to get started.

Authorities in Mexico urged people to avoid hospitals unless they had a medical emergency, since hospitals are centers of infection. They also said Mexicans should refrain from customary greetings such as shaking hands or kissing cheeks. At Mexico City's international airport, passengers were questioned to try to prevent anyone with flu symptoms from boarding airplanes and spreading the disease.

Epidemiologists are particularly concerned because the only fatalities so far were in young people and adults.

The eight U.S. victims recovered from symptoms that were like those of the regular flu, mostly fever, cough and sore throat, though some also experienced vomiting and diarrhea.

U.S. health officials announced an outbreak notice to travelers, urging caution and frequent handwashing, but stopping short of telling Americans to avoid Mexico.

Mexico's Health Secretary Jose Angel Cordoba said 68 people have died of flu and the new swine flu strain had been confirmed in 20 of those deaths. At least 1,004 people nationwide were sick from the suspected flu, he said.

The geographical spread of the outbreaks also concerned the WHO while 13 of the 20 deaths were in Mexico City, the rest were spread across Mexico four in central San Luis Potosi, two up near the U.S. border in Baja California, and one in southern Oaxaca state.

Scientists have long been concerned that a new flu virus could launch a worldwide pandemic of a killer disease. A new virus could evolve when different flu viruses infect a pig, a person or a bird, mingling their genetic material. The resulting hybrid could spread quickly because people would have no natural defenses against it.

Still, flu experts were concerned but not alarmed about the latest outbreak.

"We've seen swine influenza in humans over the past several years, and in most cases, it's come from direct pig contact. This seems to be different," said Dr. Arnold Monto, a flu expert with the University of Michigan.

"I think we need to be careful and not apprehensive, but certainly paying attention to new developments as they proceed."

The CDC says two flu drugs, Tamiflu and Relenza, seem effective against the new strain. Roche, the maker of Tamiflu, said the company is prepared to immediately deploy a stockpile of the drug if requested.

Both drugs must be taken early, within a few days of the onset of symptoms, to be most effective.

Cordoba said Mexico has enough Tamiflu to treat 1 million people, but the medicine will be strictly controlled and handed out only by doctors.

Mexico's government had maintained until late Thursday that there was nothing unusual about the flu cases, although this year's flu season had been worse and longer than past years.

The sudden turnaround by public health officials angered many Mexicans.

"They could have stopped it in time," said Araceli Cruz, 24, a university student who emerged from the subway wearing a surgical mask. "Now they've let it spread to other people."

The city was handing out free surgical masks to passengers on buses and the subway system, which carries 5 million people each day. Government workers were ordered to wear the masks, and authorities urged residents to stay home from work if they felt ill.

Closing schools across Mexico's capital of 20 million kept 6.1 million students home, as well as thousands of university students. All state and city-run cultural activities were suspended, including libraries, state-run theaters, and at least 14 museums. Private athletic clubs closed down and soccer leagues were considering canceling weekend games.

The closures were the first citywide shutdown of public gathering places since millions died in the devastating 1985 earthquake.

Mexico's response brought to mind other major outbreaks, such as when SARS hit Asia. At its peak in 2003, Beijing shuttered schools, cinemas and restaurants, and thousands of people were quarantined at home.

In March 2008, Hong Kong ordered more than a half-million students to stay home for two weeks because of a flu outbreak. It was the first such closure in Hong Kong since the outbreak of SARS, or severe acute respiratory syndrome.

"It's great they are taking precautions," said Lillian Molina, a teacher at the Montessori's World preschool in Mexico City, who scrubbed down empty classrooms with Clorox, soap and Lysol between fielding calls from worried parents.

U.S. health officials said the outbreak is not yet a reason for alarm in the United States. The five people sickened in California and three in Texas have all recovered.

It's unclear how the eight, who became ill between late March and mid-April, contracted the virus because none were in contact with pigs, which is how people usually catch swine flu. And only a few were in contact with each other.

CDC officials described the virus as having a unique combination of gene segments not seen before in people or pigs. The bug contains human virus, avian virus from North America and pig viruses from North America, Europe and Asia. It may be completely new, or it may have been around for a while and was only detected now through improved testing and surveillance, CDC officials said.

The most notorious flu pandemic is thought to have killed at least 40 million people worldwide in 1918-19. Two other, less deadly flu pandemics struck in 1957 and 1968.

Magda Hassan
04-25-2009, 06:01 AM
This one is very suspicious, as it has DNA portions from pigs, birds and humans all together. It could happen naturally, but the odds are slim.

This is what I find quite incredible too. What are the chances of this happening in real life? It's up there with the Crisman - Bannister encounters in queerness.

Peter Lemkin
04-25-2009, 06:22 AM
This one is very suspicious, as it has DNA portions from pigs, birds and humans all together. It could happen naturally, but the odds are slim.

This is what I find quite incredible too. What are the chances of this happening in real life? It's up there with the Crisman - Bannister encounters in queerness.

Again, in the past pandemics have been caused naturally by new flu varieties which usually contained flu DNA from another species that was reproducable within humans. The chances, however of TWO together are very small indeed, but not impossible. If manufactured, there are two possibilities - intentional release and accidental release or manufacture. A good virulogical team should be able to figure out the most likely origins, but it would likely take a half-year's work, maybe less. If a covert operation such a team would be penetrated or otherwise messed with, very likely. In any case it would be well after any pandemic. Biowarfare aside, this is a real and present danger known about in the environmental health field and not well appreciated by the Public. Governments and the Media have generally not wanted to panic the population and/or are themselves not aware of the dangers. Industrial animal farms are part of the problem - there are many others. Our non-Natural ways of life, generally, are producing these freak viruses.

Definition of Avian influenza:

Avian influenza is flu infection in birds. The disease is of concern to humans, who have no immunity against it. The virus that causes this infection in birds can mutate (change) to easily infect humans. Such mutation can start a deadly worldwide epidemic.
Causes, incidence, and risk factors:

Historically, avian influenza viruses infected pigs and mixed with pig influenza viruses. The viruses exchanged genetic information, which led to the formation of a new virus. This new virus could then infect humans and easily spread from person to person. Previous flu pandemics (worldwide epidemics) have started this way.

The first avian influenza virus to infect humans directly occurred in Hong Kong in 1997, during an avian flu epidemic on the island. This outbreak was linked to chickens and classified as avian influenza A (H5N1).

Since the Hong Kong outbreak, the bird flu virus has spread across Asia, and in October 2005 was discovered in poultry in Turkey and Romania. So far, hundreds of people have been infected by H5N1. Many people have died.

The wider the area over which the avian flu virus spreads, the greater the chances of a worldwide outbreak. There is tremendous concern that H5N1 poses an enormous pandemic threat.

Farmers and other people working with poultry, as well as travelers visiting affected countries, have a higher risk for getting the bird flu. Handling an infected bird can cause infection. People who eat raw or undercooked poultry meat are also at an increased risk for avian influenza. Highly infective avian flu viruses, such as H5N1, have been shown to survive in the environment for long periods of time, and infection may be spread simply by touching contaminated surfaces. Birds who recover from the flu can continue to shed the virus in their feces and saliva for as long as 10 days.

Health care workers and household contacts of patients with avian influenza may also be at an increased risk of the bird flu.
Reviewed last on: 11/9/2008
Linda Vorvick, MD, Family Physician, Seattle Site Coordinator, Lecturer, Pathophysiology, MEDEX Northwest Division of Physician Assistant Studies, University of Washington School of Medicine. Also reviewed by David Zieve, MD, MHA, Medical Director, A.D.A.M., Inc.
References

US Food and Drug Administration. FDA Approves First U.S. Vaccine for Humans Against the Avian Influenza Virus H5N1. Rockville, MD: National Press Office; April 17, 2007. Release P07-68

Levin S. Zoonoses. In: Goldman L, Ausiello D, eds. Cecil Medicine. 23rd ed. Philadelphia, Pa: Saunders Elsevier; 2007:chap 349.

Hayden FG. Influenza. In: Goldman L, Ausiello D, eds. Cecil Medicine. 23rd ed. Philadelphia, Pa: Saunders Elsevier; 2007:chap 387.

Magda Hassan
04-25-2009, 06:38 AM
Then of course there is this little exercise in best practice management: http://www.deeppoliticsforum.com/forums/showthread.php?t=940

Magda Hassan
04-25-2009, 08:13 AM
So the terror continues...may the Government save us.

"I'm from the government and I'm here to help you"

Jan Klimkowski
04-25-2009, 01:45 PM
This one is very suspicious, as it has DNA portions from pigs, birds and humans all together. It could happen naturally, but the odds are slim.

This is what I find quite incredible too. What are the chances of this happening in real life? It's up there with the Crisman - Bannister encounters in queerness.

Yup. This may have happened naturally. However it seems to have crossed two species barriers and caused a significant number of human deaths before the WHO, CDC etc have gone public.

Crisman & Banister were involved in deep black psyops & covert ops.


It is only a matter of time before there is an influenza outbreak whether by design or naturally occurring circumstances. What is known is that Donald Rumsfeld and others will be making a packet as they have shares in the pharmaceutical compnay, Gilead, that makes Tamiflu which is said to be the most effective drug against this strain. Though its rate of effectiveness is still quite low actually. IIRC

http://www.snopes.com/politics/medical/tamiflu.asp

Precisely. Absolutely crucial context.


Dr Michael Osterholm, a public health expert at the University of Minnesota, said given how quickly flu can spread around the globe, if these are the first signs of a pandemic, then there are probably cases incubating in other parts of the world already.

"Literally hundreds and thousands of travellers come in and out of Mexico City every day," Dr Osterholm said. "You'd have to believe there's been more unrecognised transmission that's occurred."

There is no vaccine that specifically protects against swine flu, and it was unclear how much protection current human flu vaccines might offer.

However, the CDC says two flu drugs, Tamiflu and Relenza, seem effective against the new strain. Roche, the maker of Tamiflu, said the company is prepared to immediately deploy a stockpile of the drug if requested.

Both drugs must be taken early, within a few days of the onset of symptoms, to be most effective. There have also been concerns that some forms of flu have been developing resistance to the drugs.

http://www.telegraph.co.uk/news/worldnews/centralamericaandthecaribbean/mexico/5219579/What-is-swine-flu.html

FFS.

:thumpdown:

Bruce Clemens
04-25-2009, 09:43 PM
Magda said:

What is known is that Donald Rumsfeld and others will be making a packet as they have shares in the pharmaceutical compnay, Gilead, that makes Tamiflu which is said to be the most effective drug against this strain.Gilead Sciences, the benefactor of royalties from Tamiflu, has had some interesting insider stock transactions lately.

I was looking for some indication that insiders were betting that the stock was going to rise...

On April 14th, John C. Martin, the CEO, sold 100,000 shares of his companys stock for almost USD 1.6 million and the same day bought 100,000 call options in the same stock.

http://www.secform4.com/filings/882095/000117911009006512.htm

The options expire on July 21, 2009.

On March 12th, he did the same thing, with the same amounts and the same expiration.

http://www.secform4.com/filings/882095/000117911009004884.htm

On February 12th he did the same thing.

http://www.secform4.com/filings/882095/000117911009002561.htm

January 15th, ditto.

http://www.secform4.com/filings/882095/000117911009001104.htm

August 08, same with 70,000 shares. Then there was Julyand June

You may know that stock options are derivatives, and derivatives are MUCH riskier than buying the underlying security. But, you can make a much larger profit per your investment dollar in derivatives than you can in the stock itself. Investing in derivatives is a gamblers game.

They've been cashing out- ready to pounce on the opportunity when their stock rises- and if it rises significantly before July 21, Mr. Martin and several others will be able to buy their shares back at guaranteed low rates, or sell the options themselves at a nice premium.

Bruce Clemens
04-26-2009, 12:34 AM
From:

http://www.reuters.com/article/latestCrisis/idUSN25479998 (http://www.reuters.com/article/latestCrisis/idUSN25479998)


Mexico gov't decrees special powers in flu crisis

Sat Apr 25, 2009 6:53pm EDT

Email (http://javascript%3Cb%3E%3C/b%3E:commonPopup%28%27/do/emailArticle?articleId=USN25479998%27,%20540,%2060 0,%201,%20%27emailPopup%27%29) | Print (http://www.reuters.com/articlePrint?articleId=USN25479998) | Share
| Reprints (http://javascript%3Cb%3E%3C/b%3E:commonPopup%28%27http://license.icopyright.net/3.5398?icx_id=N25479998.xml&icx2_id=USN25479998&section=latestCrisis%27,%20580,%20635,%201,%20%27p urchasePopup%27%29) | Single Page (http://javascript%3Cb%3E%3C/b%3E:singlePageView%28%29;)
[- (http://javascript%3Cb%3E%3C/b%3E:sizeDown%28%29;)] Text (http://javascript%3Cb%3E%3C/b%3E:resetCurrentsize%28%29;) [+ (http://javascript%3Cb%3E%3C/b%3E:sizeUp%28%29;)]




MEXICO CITY, April 25 (Reuters) - Mexican President Felipe Calderon issued an emergency decree on Saturday giving the government special powers to run tests on sick people and order them isolated to fight the deadly flu crisis.

Mexico City has already shut schools and museums and canceled sporting and cultural events as an outbreak of a new type of swine flu killed up to 68 people in the country and spread north to infect some people in the United States.

Saturday's decree, published in Mexico's official journal, gives the government power to isolate sick people, enter homes or workplaces and regulate air, sea and land transportation to try to stop further infection.

The flu has rattled residents of Mexico's overcrowded capital of some 20 million people.

Calderon tried to calm Mexicans earlier on Saturday, saying the flue was curable. He said health authorities easily had enough antiviral medicine for the 1,000 or so people suspected to be infected with the swine flu and that his government was monitoring the situation "minute by minute."

Tests on Saturday showed eight New York City schoolchildren had a type A influenza virus likely to be the same type as the Mexican flu, adding to nine people in California and Texas who tested positive for it, although they later recovered. Two swine flu cases were also confirmed in Kansas.

The World Health Organization declared the outbreaks a "public health event of international concern" and urged all countries to boost their surveillance for any unusual outbreaks of influenza-like illness and severe pneumonia.

The agency stopped short of raising the threat level to a pandemic -- a global epidemic of a serious disease.

Mexico City residents mainly hunkered down at home on Saturday, as children's parties were canceled and bars were closed and many of those on the street wore surgical masks. (Reporting by Catherine Bremer; Editing by Peter Cooney)

Bruce Clemens
04-26-2009, 12:50 AM
From
http://www.nydailynews.com/ny_local/2009/04/25/2009-04-25_nyc_health_officials_at_least_8_queens_students _likely_have_swine_flu.html

"It is clear that this is widespread," Dr. Anne Schuchat (http://www.nydailynews.com/topics/Anne+Schuchat) of the U.S. Centers for Disease Control and Prevention (http://www.nydailynews.com/topics/Centers+for+Disease+Control+and+Prevention) said.

"And that is why we have let you know that we cannot contain the spread of this virus."

Magda Hassan
04-26-2009, 02:22 AM
Magda said:

What is known is that Donald Rumsfeld and others will be making a packet as they have shares in the pharmaceutical compnay, Gilead, that makes Tamiflu which is said to be the most effective drug against this strain.Gilead Sciences, the benefactor of royalties from Tamiflu, has had some interesting insider stock transactions lately.

I was looking for some indication that insiders were betting that the stock was going to rise...

On April 14th, John C. Martin, the CEO, sold 100,000 shares of his companys stock for almost USD 1.6 million and the same day bought 100,000 call options in the same stock.

http://www.secform4.com/filings/882095/000117911009006512.htm

The options expire on July 21, 2009.

On March 12th, he did the same thing, with the same amounts and the same expiration.

http://www.secform4.com/filings/882095/000117911009004884.htm

On February 12th he did the same thing.

http://www.secform4.com/filings/882095/000117911009002561.htm

January 15th, ditto.

http://www.secform4.com/filings/882095/000117911009001104.htm

August 08, same with 70,000 shares. Then there was Julyand June

You may know that stock options are derivatives, and derivatives are MUCH riskier than buying the underlying security. But, you can make a much larger profit per your investment dollar in derivatives than you can in the stock itself. Investing in derivatives is a gamblers game.

They've been cashing out- ready to pounce on the opportunity when their stock rises- and if it rises significantly before July 21, Mr. Martin and several others will be able to buy their shares back at guaranteed low rates, or sell the options themselves at a nice premium.

Thanks for this Bruce. Very interesting. It would be good to know what his previous form is like in buying and selling for comparison purposes. I wonder who else is doing similar things?

Peter Lemkin
04-26-2009, 07:17 AM
The CDC is obviously VERY worried. This kind of virus can spread widely and quickly. Its virulance is not yet known, but is definitely on the side of quite to very virulant [having killed 80+]. The most frightening thing about such viruses is they can very quickly increase [or decrease] in virulance. If it increases and if not controlled by isolation etc. a pandemic could erupt in N.A. or worldwide. The numbers of people that travel from Mexico to the USA is huge. I wonder what the incubation period for this virus is and how long someone could be a 'silent carrier' before even knowing it, by coming down with symptoms that would clue them in not to travel - or incapacitate them to travel? The CDC is very conservative on calls like this and doesn't like to panic the public, usually. They just issued a warning that this posed a substantial and immenent worldwide danger. Unless they are trying to raise the stock of and sales of Tamiflu. :flute: It is very odd and sinister that Rummy is in on that medicine! My, what a world we live in! NB - in a full pandemic there is NOT enough antiviral drug(s) to give to everyone on the planet, not the means to distribute them quickly enough - let alone the troubling problem of the high price for the poor. I believe the drugs are only helpful if taken BEFORE infection.

The fact that Mexico City is the second largest in the World is not a good factor - population density is a big factor in such a pandemic spreading. Kansas health officials said two people there had swine flu and a seventh case emerged in California near the Mexican border, taking the number of confirmed U.S. cases to 11. A married Kansas couple both were confirmed with a mild case. The husband recently visited Mexico. The USA only because of the lack of public transportation and many sigle-family homes, has a slight advantage over other countries. Europe and the developing world use much public transport and/or have fewer single-family dewllings. I have a bad felling about this. In two days it has gone from 20 dead to 81. Increases will be exponential, if this catches on.

Another very odd fact is it is killing in Mexico, but not in the USA, yet.

CDC says too late to contain U.S. flu outbreak
24 Apr 2009 19:31:20 GMT
Source: Reuters
WASHINGTON, April 24 (Reuters) - The U.S. Centers for Disease Control and Prevention said on Friday it was too late to contain the swine flu outbreak in the United States.

CDC acting director Dr. Richard Besser told reporters in a telephone briefing it was likely too late to try to contain the outbreak, by vaccinating, treating or isolating people.

"There are things that we see that suggest that containment is not very likely," he said.

He said the U.S. cases and Mexican cases are likely the same virus. "So far the genetic elements that we have looked at are the same." But Besser said it was unclear why the virus was causing so many deaths in deaths in Mexico and such mild disease in the United States.

A new flu virus suspected of killing as many as 81 people in Mexico has the potential to become a pandemic, the World Health Organization's chief says.

Margaret Chan said the outbreak was a "health emergency of international concern" and must be closely monitored.

Health experts say tests so far seem to link the illnesses in Mexico with a swine flu virus in the southern US.

Several people have also fallen ill in the US, and the authorities there are watching the situation.

A top US health official said the strain of swine flu had spread widely and could not be contained.

Speaking after a meeting of the WHO's emergency committee, Mrs Chan said that "the current events constitute a public health emergency of international concern".

I work as a resident doctor in one of the biggest hospitals in Mexico City and sadly, the situation is far from 'under control'
Yeny Gregorio Davila, Mexico City
Read more experiences
HAVE YOUR SAY I work as a resident doctor in one of the biggest hospitals in Mexico City and sadly, the situation is far from 'under control'
Yeny Gregorio Davila, Mexico City
Read more experiences

The WHO is advising all member states to be vigilant for seasonally unusual flu or pneumonia-like symptoms among their populations - particularly among young healthy adults.

Officials said most of those killed so far in Mexico were young adults - rather than more vulnerable children and the elderly.

The committee has not recommended declaring an international public health emergency and raising the global pandemic alert level, a move that could lead to travel advisories, trade restrictions and border closures.

New strain

At least some of the cases show a new version of the H1N1 swine flu sub-strain - a respiratory disease which infects pigs but only sporadically infects humans.

The RC church has issued advice to its priests to help halt the spread of the flu


H1N1 is the same strain that causes seasonal flu outbreaks in humans, but the newly-detected version contains genetic material from versions which usually affect pigs and birds.

The virus is spread through coughs and sneezes and through direct and indirect contact between people.

Mexican officials have confirmed 20 deaths from the virus and are investigating dozens more.

Schools, museums and libraries have been closed across the capital's region and people are being urged to avoid shaking hands or sharing crockery.

Hundreds of public events have been suspended and schools in the Mexico City area have been closed until 6 May.

Two previously sold-out soccer matches were played in empty stadiums to avoid potentially spreading the virus.

Health officials are isolating individuals suspected of having the virus and inspecting their homes.

The Roman Catholic Church in Mexico has recommended measures to avoid further contagion at Mass this Sunday.

Priests have been told to place communion wafers in the hands of worshippers rather than in their mouths and to suggest to the congregation that kissing or shaking hands be avoided during the service.

'Caution'

In the US, 11 people are now known to have been infected with the new strain - seven people in California, two in Texas, and two in Kansas.

There are also eight suspected cases in New York City after 200 students at a high school fell ill.

Specimens were taken from nine students, and eight were determined to be probable cases of swine flu, said city health commissioner Dr Thomas Frieden.

Those samples are now being examined by the US Centers for Disease Control and Prevention (CDC).

No children had required hospital treatment and many had fully recovered, said Dr Frieden, but the school could remain closed out of "an abundance of caution".

He urged people to maintain basic hygiene, such and covering their mouths when coughing and sneezing, washing hands regularly and keeping surfaces clean.

Dr Frieden said most people would not need to take antiviral medication if they fell ill, unless they had an underlying medical condition.

Hopeful sign

CDC officials have said that with cases arising in so many communities, containment is unlikely to be feasible.

There is currently no vaccine for the new strain.
SWINE FLU
Swine flu is a respiratory disease found in pigs
Human cases usually occur in those who have contact with pigs
Human-to-human transmission is rare and such cases are closely monitored
Q&A: Swine flu
UK monitoring flu outbreak



Tom Skinner of the CDC told the BBC that it was too early too tell how widespread the impact would be.

"We don't know how well or efficiently this virus is spreading and how easily it is going to be sustained in the human population."

He said it was not yet clear which side of the border the virus had originated.

But the US was likely to take "normal and routine" steps within the next few days to screen passengers coming into the US and to distribute information, he said.

The CDC plans to send experts to Mexico to help investigate the virus which has infected more than 1,000 people in the country.

The BBC science editor Susan Watts says the new strain is a classic "re-assortment" - a combination feared most by those watching for the flu pandemic.

This from the CDC website front page:
Clinicians should consider the possibility of swine influenza virus infections in patients presenting with febrile respiratory illness who:
Live in San Diego County or Imperial County, California or San Antonio, Texas or
Have traveled to San Diego and/or Imperial County, California or San Antonio, Texas or
Have been in contact with ill persons from these areas in the 7 days prior to their illness onset.

If swine flu is suspected, clinicians should obtain a respiratory swab for swine influenza testing and place it in a refrigerator (not a freezer). Once collected, the clinician should contact their state or local health department to facilitate transport and timely diagnosis at a state public health laboratory.
State Public Health Laboratories

Laboratories should send all unsubtypable influenza A specimens as soon as possible to the Viral Surveillance and Diagnostic Branch of the CDCs Influenza Division for further diagnostic testing.
Public Health /Animal Health Officials

Officials should conduct thorough case and contact investigations to determine the source of the swine influenza virus, extent of community illness and the need for timely control measures.

Peter Lemkin
04-26-2009, 10:03 AM
In the last few hours it has spread to New Zealand - a group of student coming from Mexico via the USA. This could be the 'Big One'!

Magda Hassan
04-26-2009, 10:18 AM
Well if it is in NZ, likely to be here tomorrow then if not already. It was the soldiers returning home after WW1 which enabled the Spanish flu to spread it so widely. With modern air travel it just makes it so much easier to spead germs. Plus all that lovely recycled air and germs from the air conditioners.

Peter Lemkin
04-26-2009, 10:34 AM
Well if it makes you feel better it is in a city I was to fly into in two months time....but a virus like this would spread like the fires did there...fast and then faster. Better dig a hole in the back yard and put air filters on it that collect even viral particles...or stock up on the two drugs. I just checked their price and availability on the internet. Still available, but prices are going up. I guess the guys into derivatives and futures will have a field day as the rest of us die - may they be the first.

Peter Lemkin
04-26-2009, 10:53 AM
The Influenza Pandemic of 1918
http://virus.stanford.edu/uda/

The influenza pandemic of 1918-1919 killed more people than the Great War, known today as World War I (WWI), at somewhere between 20 and 40 million people. It has been cited as the most devastating epidemic in recorded world history. More people died of influenza in a single year than in four-years of the Black Death Bubonic Plague from 1347 to 1351. Known as "Spanish Flu" or "La Grippe" the influenza of 1918-1919 was a global disaster.


The Grim Reaper by Louis Raemaekers

In the fall of 1918 the Great War in Europe was winding down and peace was on the horizon. The Americans had joined in the fight, bringing the Allies closer to victory against the Germans. Deep within the trenches these men lived through some of the most brutal conditions of life, which it seemed could not be any worse. Then, in pockets across the globe, something erupted that seemed as benign as the common cold. The influenza of that season, however, was far more than a cold. In the two years that this scourge ravaged the earth, a fifth of the world's population was infected. The flu was most deadly for people ages 20 to 40. This pattern of morbidity was unusual for influenza which is usually a killer of the elderly and young children. It infected 28% of all Americans (Tice). An estimated 675,000 Americans died of influenza during the pandemic, ten times as many as in the world war. Of the U.S. soldiers who died in Europe, half of them fell to the influenza virus and not to the enemy (Deseret News). An estimated 43,000 servicemen mobilized for WWI died of influenza (Crosby). 1918 would go down as unforgettable year of suffering and death and yet of peace. As noted in the Journal of the American Medical Association final edition of 1918:

"The 1918 has gone: a year momentous as the termination of the most cruel war in the annals of the human race; a year which marked, the end at least for a time, of man's destruction of man; unfortunately a year in which developed a most fatal infectious disease causing the death of hundreds of thousands of human beings. Medical science for four and one-half years devoted itself to putting men on the firing line and keeping them there. Now it must turn with its whole might to combating the greatest enemy of all--infectious disease," (12/28/1918).




An Emergency Hospital for Influenza Patients

The effect of the influenza epidemic was so severe that the average life span in the US was depressed by 10 years. The influenza virus had a profound virulence, with a mortality rate at 2.5% compared to the previous influenza epidemics, which were less than 0.1%. The death rate for 15 to 34-year-olds of influenza and pneumonia were 20 times higher in 1918 than in previous years (Taubenberger). People were struck with illness on the street and died rapid deaths. One anectode shared of 1918 was of four women playing bridge together late into the night. Overnight, three of the women died from influenza (Hoagg). Others told stories of people on their way to work suddenly developing the flu and dying within hours (Henig). One physician writes that patients with seemingly ordinary influenza would rapidly "develop the most viscous type of pneumonia that has ever been seen" and later when cyanosis appeared in the patients, "it is simply a struggle for air until they suffocate," (Grist, 1979). Another physician recalls that the influenza patients "died struggling to clear their airways of a blood-tinged froth that sometimes gushed from their nose and mouth," (Starr, 1976). The physicians of the time were helpless against this powerful agent of influenza. In 1918 children would skip rope to the rhyme (Crawford):

I had a little bird,
Its name was Enza.
I opened the window,
And in-flu-enza.


The influenza pandemic circled the globe. Most of humanity felt the effects of this strain of the influenza virus. It spread following the path of its human carriers, along trade routes and shipping lines. Outbreaks swept through North America, Europe, Asia, Africa, Brazil and the South Pacific (Taubenberger). In India the mortality rate was extremely high at around 50 deaths from influenza per 1,000 people (Brown). The Great War, with its mass movements of men in armies and aboard ships, probably aided in its rapid diffusion and attack. The origins of the deadly flu disease were unknown but widely speculated upon. Some of the allies thought of the epidemic as a biological warfare tool of the Germans. Many thought it was a result of the trench warfare, the use of mustard gases and the generated "smoke and fumes" of the war. A national campaign began using the ready rhetoric of war to fight the new enemy of microscopic proportions. A study attempted to reason why the disease had been so devastating in certain localized regions, looking at the climate, the weather and the racial composition of cities. They found humidity to be linked with more severe epidemics as it "fosters the dissemination of the bacteria," (Committee on Atmosphere and Man, 1923). Meanwhile the new sciences of the infectious agents and immunology were racing to come up with a vaccine or therapy to stop the epidemics.

The experiences of people in military camps encountering the influenza pandemic:


An excerpt for the memoirs of a survivor at Camp Funston of the pandemic Survivor

A letter to a fellow physician describing conditions during the influenza epidemic at Camp Devens

A collection of letters of a soldier stationed in Camp Funston Soldier

The origins of this influenza variant is not precisely known. It is thought to have originated in China in a rare genetic shift of the influenza virus. The recombination of its surface proteins created a virus novel to almost everyone and a loss of herd immunity. Recently the virus has been reconstructed from the tissue of a dead soldier and is now being genetically characterized. The name of Spanish Flu came from the early affliction and large mortalities in Spain (BMJ,10/19/1918) where it allegedly killed 8 million in May (BMJ, 7/13/1918). However, a first wave of influenza appeared early in the spring of 1918 in Kansas and in military camps throughout the US. Few noticed the epidemic in the midst of the war. Wilson had just given his 14 point address. There was virtually no response or acknowledgment to the epidemics in March and April in the military camps. It was unfortunate that no steps were taken to prepare for the usual recrudescence of the virulent influenza strain in the winter. The lack of action was later criticized when the epidemic could not be ignored in the winter of 1918 (BMJ, 1918). These first epidemics at training camps were a sign of what was coming in greater magnitude in the fall and winter of 1918 to the entire world.

The war brought the virus back into the US for the second wave of the epidemic. It first arrived in Boston in September of 1918 through the port busy with war shipments of machinery and supplies. The war also enabled the virus to spread and diffuse. Men across the nation were mobilizing to join the military and the cause. As they came together, they brought the virus with them and to those they contacted. The virus killed almost 200,00 in October of 1918 alone. In November 11 of 1918 the end of the war enabled a resurgence. As people celebrated Armistice Day with parades and large partiess, a complete disaster from the public health standpoint, a rebirth of the epidemic occurred in some cities. The flu that winter was beyond imagination as millions were infected and thousands died. Just as the war had effected the course of influenza, influenza affected the war. Entire fleets were ill with the disease and men on the front were too sick to fight. The flu was devastating to both sides, killing more men than their own weapons could.


With the military patients coming home from the war with battle wounds and mustard gas burns, hospital facilities and staff were taxed to the limit. This created a shortage of physicians, especially in the civilian sector as many had been lost for service with the military. Since the medical practitioners were away with the troops, only the medical students were left to care for the sick. Third and forth year classes were closed and the students assigned jobs as interns or nurses (Starr,1976). One article noted that "depletion has been carried to such an extent that the practitioners are brought very near the breaking point," (BMJ, 11/2/1918). The shortage was further confounded by the added loss of physicians to the epidemic. In the U.S., the Red Cross had to recruit more volunteers to contribute to the new cause at home of fighting the influenza epidemic. To respond with the fullest utilization of nurses, volunteers and medical supplies, the Red Cross created a National Committee on Influenza. It was involved in both military and civilian sectors to mobilize all forces to fight Spanish influenza (Crosby, 1989). In some areas of the US, the nursing shortage was so acute that the Red Cross had to ask local businesses to allow workers to have the day off if they volunteer in the hospitals at night (Deseret News). Emergency hospitals were created to take in the patients from the US and those arriving sick from overseas.


The pandemic affected everyone. With one-quarter of the US and one-fifth of the world infected with the influenza, it was impossible to escape from the illness. Even President Woodrow Wilson suffered from the flu in early 1919 while negotiating the crucial treaty of Versailles to end the World War (Tice). Those who were lucky enough to avoid infection had to deal with the public health ordinances to restrain the spread of the disease. The public health departments distributed gauze masks to be worn in public. Stores could not hold sales, funerals were limited to 15 minutes. Some towns required a signed certificate to enter and railroads would not accept passengers without them. Those who ignored the flu ordinances had to pay steep fines enforced by extra officers (Deseret News). Bodies pilled up as the massive deaths of the epidemic ensued. Besides the lack of health care workers and medical supplies, there was a shortage of coffins, morticians and gravediggers (Knox). The conditions in 1918 were not so far removed from the Black Death in the era of the bubonic plague of the Middle Ages.

In 1918-19 this deadly influenza pandemic erupted during the final stages of World War I. Nations were already attempting to deal with the effects and costs of the war. Propaganda campaigns and war restrictions and rations had been implemented by governments. Nationalism pervaded as people accepted government authority. This allowed the public health departments to easily step in and implement their restrictive measures. The war also gave science greater importance as governments relied on scientists, now armed with the new germ theory and the development of antiseptic surgery, to design vaccines and reduce mortalities of disease and battle wounds. Their new technologies could preserve the men on the front and ultimately save the world. These conditions created by World War I, together with the current social attitudes and ideas, led to the relatively calm response of the public and application of scientific ideas. People allowed for strict measures and loss of freedom during the war as they submitted to the needs of the nation ahead of their personal needs. They had accepted the limitations placed with rationing and drafting. The responses of the public health officials reflected the new allegiance to science and the wartime society. The medical and scientific communities had developed new theories and applied them to prevention, diagnostics and treatment of the influenza patients.

Return to the Top

Graphs of the Influenza Epidemic Impact

The Public Health Response
Authoritative Measures
Preventative Measures
Prophylaxis


The Scientific and Medical Response
Clinical Descriptions
Treatment and Therapy
The Etiology of Influenza


Bibliography
by Molly Billings, June, 1997 modified RDS February, 2005

Peter Lemkin
04-26-2009, 11:04 AM
1918 flu pandemic
From Wikipedia, the free encyclopedia

The 1918 flu pandemic (commonly referred to as the Spanish flu) was an influenza pandemic that spread to nearly every part of the world. It was caused by an unusually virulent and deadly Influenza A virus strain of subtype H1N1. Historical and epidemiologic data are inadequate to identify the geographic origin of the virus.[1] Most of its victims were healthy young adults, in contrast to most influenza outbreaks which predominantly affect juvenile, elderly, or otherwise weakened patients. The pandemic lasted from March 1918 to June 1920,[2] spreading even to the Arctic and remote Pacific islands. It is estimated that anywhere from 20 to 100 million people were killed worldwide,[3] or the approximate equivalent of one third of the population of Europe,[4][5][6] more than double the number killed in World War I.[7] This extraordinary toll resulted from the extremely high illness rate of up to 50% and the extreme severity of the symptoms, suspected to be caused by cytokine storms. The pandemic is estimated to have infected up to one billion people: half the world's population at the time.[8]

The flu probably originated in the Far East.[9] The disease was first observed at Fort Riley, Kansas, United States, on March 4, 1918,[10] and Queens, New York, on March 11, 1918. In August 1918, a more virulent strain appeared simultaneously in Brest, France, in Freetown, Sierra Leone, and in the U.S. at Boston, Massachusetts. The Allies of World War I came to call it the Spanish flu, primarily because the pandemic received greater press attention after it moved from France to Spain in November 1918. Spain was not involved in the war and had not imposed wartime censorship.[11]

Scientists have used tissue samples from frozen victims to reproduce the virus for study. Given the strain's extreme virulence there has been controversy regarding the wisdom of such research. Among the conclusions of this research is that the virus kills via a cytokine storm (overreaction of the body's immune system) which explains its unusually severe nature and the concentrated age profile of its victims. The strong immune systems of young adults ravaged the body, whereas the weaker immune systems of children and middle-aged adults caused fewer deaths.Contents [hide]
1 Mortality
2 History
2.1 Patterns of fatality
2.2 Devastated communities
2.3 Less affected areas
2.4 Government response
2.5 Cultural impact
3 Spanish flu research
4 Victims
4.1 Notable fatalities
4.2 Notable survivors
4.3 Fictional
5 See also
6 References
7 Further reading
8 External links


[edit]
Mortality

The difference between the influenza mortality age-distributions of the 1918 epidemic and normal epidemics. Deaths per 100,000 persons in each age group, United States, for the interpandemic years 19111917 (dashed line) and the pandemic year 1918 (solid line).[12]

Chart of deaths in major cities

The global mortality rate from the 1918/1919 pandemic is not known, but is estimated at 2.5 to 5% of the human population, with 20% or more of the world population suffering from the disease to some extent. Influenza may have killed as many as 25 million in its first 25 weeks (in contrast, AIDS killed 25 million in its first 25 years)[citation needed]. Older estimates say it killed 4050 million people[3] while current estimates say 50 million to 100 million people worldwide were killed.[13] This pandemic has been described as "the greatest medical holocaust in history" and may have killed more people than the Black Death.[14]

An estimated 7 million died in India, about 2.78% of India's population at the time. In the Indian Army, almost 22% of troops who caught the disease died of it[citation needed]. In the U.S., about 28% of the population suffered, and 500,000 to 675,000 died.[15] In Britain as many as 250,000 died; in France more than 400,000. In Canada approximately 50,000 died. Entire villages perished in Alaska and southern Africa. Ras Tafari (the future Haile Selassie) was one of the first Ethiopians who contracted influenza but survived,[16] although many of his subjects did not; estimates for the fatalities in the capital city, Addis Ababa, range from 5,000 to 10,000, with some experts opining that the number was even higher,[17] while in British Somaliland one official there estimated that 7% of the native population died from influenza.[18] In Australia an estimated 12,000 people died and in the Fiji Islands, 14% of the population died during only two weeks, and in Western Samoa 22%.

This huge death toll was caused by an extremely high infection rate of up to 50% and the extreme severity of the symptoms, suspected to be caused by cytokine storms.[3] Indeed, symptoms in 1918 were so unusual that initially influenza was misdiagnosed as dengue, cholera, or typhoid. One observer wrote, "One of the most striking of the complications was hemorrhage from mucous membranes, especially from the nose, stomach, and intestine. Bleeding from the ears and petechial hemorrhages in the skin also occurred."[13] The majority of deaths were from bacterial pneumonia, a secondary infection caused by influenza, but the virus also killed people directly, causing massive hemorrhages and edema in the lung.[12]

The unusually severe disease killed between 2 and 20% of those infected, as opposed to the more usual flu epidemic mortality rate of 0.1%.[12][13] Another unusual feature of this pandemic was that it mostly killed young adults, with 99% of pandemic influenza deaths occurring in people under 65, and more than half in young adults 20 to 40 years old.[19] This is unusual since influenza is normally most deadly to the very young (under age 2) and the very old (over age 70), and may have been due to partial protection caused by exposure to a previous Russian flu pandemic of 1889.[20]

[edit]
History

While World War I did not cause the flu, the close troop quarters and massive troop movements hastened the pandemic. Some researchers speculate that the soldiers' immune systems were weakened by the stresses of combat and chemical attacks, increasing their susceptibility to the disease.[21]

A large factor of worldwide flu occurrence was increased travel. Modern transportation systems made it easier for soldiers, sailors, and civilian travelers to spread the disease quickly to communities worldwide.

American Red Cross nurses tend to flu patients in temporary wards set up inside Oakland Municipal Auditorium, 1918

Two poems, dedicated to the Spanish flu, were popular in those days[citation needed]:

I had a little bird,
Its name was Enza,
I opened the window,
And in-flew-enza.
-American Skipping Rhyme circa 1918

Obey the laws
And wear the gauze.
Protect your jaws
From septic paws.

[edit]
Patterns of fatality

The influenza strain was unusual in that this pandemic killed many young adults and otherwise healthy victims; typical influenzas kill mostly infants (aged 02 years), the elderly, and the immunocompromised. Another oddity was that this influenza outbreak was widespread in summer and fall (in the Northern Hemisphere). Typically, influenza is worse in the winter months.

People without symptoms could be stricken suddenly and within hours be too weak to walk; many died the next day. Symptoms included a blue tint to the face and coughing up blood caused by severe obstruction of the lungs. In some cases, the virus caused an uncontrollable hemorrhaging that filled the lungs, and patients drowned in their body fluids (pneumonia). In others, the flu caused frequent loss of bowel control and the victim would die from losing critical intestinal lining and blood loss.[citation needed]

In fast-progressing cases, mortality was primarily from pneumonia, by virus-induced consolidation. Slower-progressing cases featured secondary bacterial pneumonias, and there may have been neural involvement that led to mental disorders in a minority of cases. Some deaths resulted from malnourishment and even animal attacks in overwhelmed communities.[citation needed]

[edit]
Devastated communities

Street car conductor in Seattle not allowing passengers aboard without a mask in 1918.

In most places less than one-third of the population was infected, only a small percentage of whom died. In a number of towns in several countries entire populations were wiped out.[citation needed]

Even in areas where mortality was low, those incapacitated by the illness were often so numerous as to bring much of everyday life to a stop. Some communities closed all stores or required customers not to enter the store but place their orders outside the store for filling. There were many reports of places with no health care workers to tend the sick because of their own ill health and no able-bodied grave diggers to bury the dead. Mass graves were dug by steam shovel and bodies buried without coffins in many places.[citation needed]

Several Pacific island territories were particularly hard-hit. The pandemic reached them from New Zealand, which belatedly implemented measures to prevent ships carrying the flu from leaving its ports. From New Zealand, the flu reached Tonga (killing 8% of the population), Nauru (16%) and Fiji (5%, 9000 people). Worst affected was Western Samoa, a territory then under New Zealand military administration. A crippling 90% of the population was infected; 30% of adult men, 22% of adult women and 10% of children were killed. By contrast, "[t]he flu was excluded from American Samoa by a commander who imposed a blockade".[22] The mortality rate in New Zealand itself was 5%.[23]

[edit]
Less affected areas

In Japan, 257,363 deaths were attributed to influenza by July 1919, giving an estimated 0.425% mortality rate, much lower than nearly all other Asian countries for which data are available. The Japanese government severely restricted maritime travel to and from the home islands when the pandemic struck.

In the Pacific, American Samoa[24] and the French colony of New Caledonia [25] also succeeded in preventing even a single death from influenza through effective quarantines. In Australia, nearly 12,000 perished.[26]

[edit]
Government response

The Great Influenza was the source of much fear in citizens around the world. Further inflaming that fear was the fact that governments and health officials were downplaying the influenza. While the panic from WWI was dwindling, governments attempted to keep morale up by spreading lies and dismissing the influenza. On Sept. 11, 1918, Washington officials reported that the Spanish Influenza had arrived in the city. The following day, roughly thirteen million men across the country lined up to register for the war draft, providing the influenza with an efficient way to spread. However, the influenza had little impact upon institutions and organizations. While medical scientists did rapidly attempt to discover a cure or vaccine, there were virtually no changes in the government or corporations. Additionally, the political and military events were fairly unaffected due to the impartiality of the disease, which affected both sides alike.[27]

[edit]
Cultural impact The examples and perspective in this article may not represent a worldwide view of the subject. Please improve this article or discuss the issue on the talk page.


In the United States, Great Britain and other countries, despite the relatively high morbidity and mortality rates that resulted from the epidemic in 1918-1919, the Spanish flu began to fade from public awareness over the decades until the arrival of frightening news about bird flu and other pandemics in the 1990s and 2000s.[28] This has led some historians to label the Spanish flu a forgotten pandemic.[29] Indeed, one of the only major works of American literature written after 1918 that deals directly with the Spanish flu is Katherine Anne Porters Pale Horse, Pale Rider. However, in 1937 William Keepers Maxwell, Jr., the American novelist, wrote They Came Like Swallows, a fictional reconstruction of the events surrounding his mother's death from the flu. Mary McCarthy, the American novelist and essayist, also wrote about her parents' deaths in Memories of a Catholic Girlhood. In 1992 Bodie and Brock Thoene's "Shiloh Legacy Series" leads off with an account of the Spanish Flu in New York and Arkansas in their fictional novel, "In My Father's House." More recently (2006), author Thomas Mullen wrote a novel called The Last Town on Earth, about the impact of the Spanish flu on a fictional mill town in Washington and author Myra Goldberg wrote a novel called Wickett's Remedy that is set in Boston during the pandemic.

Several theories have been offered as to why the Spanish flu may have been forgotten by historians and the public over so many years. These include the rapid pace of the pandemic (it killed most of its victims in the United States, for example, within a period of less than nine months); previous familiarity with pandemic disease in the late 19th and early 20th centuries; and the distraction of the First World War.[30]

Another explanation involves the age group affected by the disease. The majority of fatalities, in both World War I and in the Spanish Flu epidemic, were young adults. The deaths caused by the flu may have been overlooked due to the large numbers of deaths of young men in the war or as a result of injuries, shortly afterwards. When people read the obituaries of the era, they saw the war or post-war deaths and the deaths from the influenza side by side. Particularly in Europe, where the war's toll was extremely high, the flu may not have had a great, separate, psychological impact, or may have seemed a mere "extension" of the war's tragedies.[31] The fact that the disease would usually only affect a certain area for a month before leaving, left little time for the disease to have a significant impact on the economy. During this time period pandemic outbreaks were not uncommon: typhoid, yellow fever, diphtheria, and cholera all occurred near the same time period. These outbreaks probably lessened the significance of the influenza pandemic for the public.[32]

[edit]
Spanish flu research
Main article: Spanish flu research

Centers for Disease Control and Preventions Dr. Terrence Tumpey examining a reconstructed version of the 1918 flu.

One theory is that the virus strain originated at Fort Riley, Kansas, by two genetic mechanisms genetic drift and antigenic shift in viruses in poultry and swine which the fort bred for food, but evidence from a recent reconstruction of the virus suggests that it jumped directly from birds to humans, without traveling through swine. The soldiers were then sent from Fort Riley to different places around the world, where they spread the disease.[33]

An effort to recreate the 1918 flu strain (a subtype of avian strain H1N1) was a collaboration among the Armed Forces Institute of Pathology, Southeast Poultry Research Laboratory and Mount Sinai School of Medicine in New York; the effort resulted in the announcement (on October 5, 2005) that the group had successfully determined the virus's genetic sequence, using historic tissue samples recovered from a female flu victim buried in the Alaskan permafrost and samples preserved from American soldiers.[34]

On January 18, 2007, Kobasa et al. reported that monkeys (Macaca fascicularis) infected with the recreated strain exhibited classic symptoms of the 1918 pandemic and died from a cytokine storm[35] an overreaction of the immune system. This may explain why the 1918 flu had its surprising effect on younger, healthier people, as a person with a stronger immune system would potentially have a stronger overreaction.[36]

On September 16, 2008, the body of Yorkshire landowner Sir Mark Sykes was exhumed to study the RNA of the Spanish flu virus in efforts to understand the genetic structure of modern H5N1 bird flu. Sykes had been buried in 1919 in a lead coffin which scientists hope will have helped preserve the virus.[37]

In December, 2008 research by Yoshihiro Kawaoka of University of Wisconsin linked the presence of three specific genes (termed PA, PB1, and PB2) and a nucleoprotein derived from 1918 flu samples to the ability of the flu virus to invade the lungs and cause pneumonia. The combination triggered similar symptoms in animal testing.[38]

Bruce Clemens
04-26-2009, 10:17 PM
Look at Novavax's stock surge since Friday.

http://www.google.com/finance?hl=en&ie=UTF-8&q=novavax&sa=N&tab=we&um=1

Researchers from Novavax and the Centers for Disease (http://www.associatedcontent.com/theme/1463/disease.html) Control and Prevention vaccinated mice and ferrets with H1N1. All of the immunized mice and ferrets were protected when exposed to a lethal dose of the 1918 influenza virus, and those animals that were immunized by the intranasal route were also protected against a lethal dose of a highly pathogenic bird flu strain.

This is the first time protection against strains with different HA types has been reported. Having one vaccine which can protect against multiple strains of flu would be a great help when faced with pandemic flu situations, such as the current swine flu outbreak. A vaccine which can protect against multiple strains of flu is ideal for agencies such as the Centers for Disease (http://www.associatedcontent.com/theme/1463/disease.html) Control and Prevention who stockpile vaccines for administration during the first wave of the pandemics.

http://www.associatedcontent.com/article/1684714/new_vaccine_protects_against_multiple.html?cat=5

Bruce Clemens
04-27-2009, 12:04 AM
The first case was seen in Mexico on April 13. The outbreak coincided with the President Barack Obama (http://search.bloomberg.com/search?q=Barack+Obama&site=wnews&client=wnews&proxystylesheet=wnews&output=xml_no_dtd&ie=UTF-8&oe=UTF-8&filter=p&getfields=wnnis&sort=date:D:S:d1)s trip to Mexico City on April 16. Obama was received at Mexicos anthropology museum in Mexico City by Felipe Solis, a distinguished archeologist who died the following day from symptoms similar to flu, Reforma newspaper reported. The newspaper didnt confirm if Solis had swine flu or not.

http://www.bloomberg.com/apps/news?pid=20601087&sid=aEsNownABJ6Q&refer=home

Obama met in Mexico City with the director of the city's Museum of Anthropology, who died a week later from symptoms similar to flu. According to Mexico health officials, he did not have swine flu but had a preexisting condition and died of pneumonia.

http://www.latimes.com/news/nationworld/nation/la-sci-swine-obama27-2009apr27,0,2301972.story

Peter Lemkin
04-27-2009, 04:29 AM
The first case was seen in Mexico on April 13. The outbreak coincided with the President Barack Obama (http://search.bloomberg.com/search?q=Barack+Obama&site=wnews&client=wnews&proxystylesheet=wnews&output=xml_no_dtd&ie=UTF-8&oe=UTF-8&filter=p&getfields=wnnis&sort=date:D:S:d1)s trip to Mexico City on April 16. Obama was received at Mexicos anthropology museum in Mexico City by Felipe Solis, a distinguished archeologist who died the following day from symptoms similar to flu, Reforma newspaper reported. The newspaper didnt confirm if Solis had swine flu or not.

http://www.bloomberg.com/apps/news?pid=20601087&sid=aEsNownABJ6Q&refer=home

Obama met in Mexico City with the director of the city's Museum of Anthropology, who died a week later from symptoms similar to flu. According to Mexico health officials, he did not have swine flu but had a preexisting condition and died of pneumonia.

http://www.latimes.com/news/nationworld/nation/la-sci-swine-obama27-2009apr27,0,2301972.story


My, my, What a coincidence!.....add to that Rumsfeld's connections to the 'cure' and voila.....time for an investigation outside of the purely medical one....don't hold your breath [unless some with the flu sneezes near you].

Magda Hassan
04-27-2009, 04:42 AM
Very interesting isn't it? Assassination (attempt) by virus? Reminds me of the attempt on Carter by the two whose names contained 'Lee Harvey Oswald' Just a warning about who is in charge. I wonder how Obama is taking it all? I wonder who arranged the visit to Mexico? And when?

Peter Lemkin
04-27-2009, 05:14 AM
Very interesting isn't it? Assassination (attempt) by virus? Reminds me of the attempt on Carter by the two whose names contained 'Lee Harvey Oswald' Just a warning about who is in charge. I wonder how Obama is taking it all? I wonder who arranged the visit to Mexico? And when?

Well, as far as I know the President and top officials regularly take several drugs to ward-off antrax, flu and other diseases. There are also easier ways to kill a President [Dallas or (fill-in the assasination or accident)]. If it was such, it also put the whole f'n Planet at risk. Now 110 dead and counting.....

....the most frightening thing I just heard was an interview with a top World virologist who said he sees signs the virus is now starting to form more virulent forms [this is a natural process with this kind of new virus the human body is not used to]. If this happens [and it can continue to happen over and over], things will be very grim indeed. It seems [best I can find out now - very limited information] that the incubation period is about one week [when the person is symptomless]...the longer, the more dangerous they will / can infect others without knowing it. This is the middle range of incubation period, but not a good number.

The most puzzling thing is that the only dead have been in Mexico, while by the odds some in the USA and elsewhere should also find it fatal. Second, it is most virulent to those in the age range 20-40, just as the 'Spanish Flu' of 1918. It seems to be a new varient of that old one perhaps? Flu usually most effects the very young and the very old - and show NO preference for nationality. Many puzzles here. One other thing. Read the article below and not the timing - just days before the flu outbreak....hmmm.....

http://www.boston.com/news/science/article...thogen_mystery/


WASHINGTON - The US Army Medical Research Institute of Infectious Diseases in Frederick, Md., is under investigation by the Army's Criminal Investigation Command for the possible disappearance of some of its stock of deadly pathogens, an Army spokesman said.

The Frederick News-Post reported yesterday that since at least February, agents have been trying to discover what happened to pathogens that may have gone missing from 1987 to 2008. The investigation coincides with the suspension of most research at the Army lab in February as authorities attempt to find errors in an inventory of their biological materials.

Christopher Grey, public affairs chief for the Criminal Investigation Command, confirmed yesterday that the command is investigating the possibility of missing virus samples from the institute. "We have an ongoing investigation at Fort Detrick," Grey said, but he declined to say when the investigation began or when it is likely to be completed.

The investigation seems to center on missing samples of Venezuelan equine encephalitis, a mosquito-borne virus that usually causes a mild flulike illness but can also cause brain inflammation and death. It has potential for use as a biological weapon, but is far less lethal than some other agents the lab works with, such as anthrax bacteria and Ebola virus.

The News-Post cited two support staff members who said they had been questioned by investigators from Fort Meade, Md., about missing samples of the virus. Alan Schmaljohn, a longtime scientist at the lab who now works for the University of Maryland, said he had also been questioned two or three months ago as someone who once had access to the virus.

"They caught me on my cellphone on the road and I stopped and talked to them for quite a long time," Schmaljohn said.

Schmaljohn said it wasn't clear from the questions exactly what the investigators sought, though he believed they wanted to know what happened to three missing vials carrying small quantities of the virus.

"The number of vials is utterly meaningless," Schmaljohn said. "Three vials missing is no indication of any evildoing. . . . It's almost equivalent to saying you're missing 3 cents out of the national budget. . . . From the scientists' point of view it is inconsequential, but from the regulator's point of view it is an indication of sloppiness, and they are finally going to take rugged action."

A problem in accounting for Venezuelan equine encephalitis was what triggered the earlier suspension of most research at the lab. A spot check in January found 20 samples of the virus in a box of vials instead of the 16 that had been listed in the institute's database, Caree Vander Linden, the spokeswoman for the institute, said in February.

The lab has been under heavy pressure to tighten security since anthrax attacks in 2001 that killed five people and sickened 17 others. FBI investigators think the anthrax strain used in the attacks originated at the Army lab, and its prime suspect, Bruce E. Ivins, researched anthrax there. Ivins committed suicide last year.

Magda Hassan
04-27-2009, 06:54 AM
I suspect that there are more effective ways to threaten him but time and place certainly are very interesting.


The most puzzling thing is that the only dead have been in Mexico, while by the odds some in the USA and elsewhere should also find it fatal. Second, it is most virulent to those in the age range 20-40, just as the 'Spanish Flu' of 1918. It seems to be a new varient of that old one perhaps? Flu usually most effects the very young and the very old - and show NO preference for nationality.The holy grail for some eugenicists is to have a racially targeted means to reduce the population. Hitler tried to achieve this in a very heavy handed uncouth way but perhaps in the near future with the miracle of modern science..... it will once again be Springtime for Hitler and Germany

By the way, nothing like the threat of a pandemic to take people's minds off the continued bankers coup/ unemployment/ homelessness/ war and what a good way for the installation of draconian social control measures? Perhaps with a free bail out to Big Pharma thrown in for good measure.

Peter Lemkin
04-27-2009, 11:01 AM
I suspect that there are more effective ways to threaten him but time and place certainly are very interesting.


The most puzzling thing is that the only dead have been in Mexico, while by the odds some in the USA and elsewhere should also find it fatal. Second, it is most virulent to those in the age range 20-40, just as the 'Spanish Flu' of 1918. It seems to be a new varient of that old one perhaps? Flu usually most effects the very young and the very old - and show NO preference for nationality.The holy grail for some eugenicists is to have a racially targeted means to reduce the population. Hitler tried to achieve this in a very heavy handed uncouth way but perhaps in the near future with the miracle of modern science..... it will once again be Springtime for Hitler and Germany

By the way, nothing like the threat of a pandemic to take people's minds off the continued bankers coup/ unemployment/ homelessness/ war and what a good way for the installation of draconian social control measures? Perhaps with a free bail out to Big Pharma thrown in for good measure.

Geneva - The Swiss pharmaceutical giant Roch, maker of influenza medication Tamiflu, saw its stock price rise 3.8 per cent in early trading Monday on the Zurich exchange on the back of the global swine flu outbreak. During the avian flu epidemic the drug was used heavily, particularly in South Asia.

Shares in Roche were trading at close to 145 Swiss francs (126 dollars), up over five francs since the opening.

Martina Rupp, a spokeswoman for Roche, said Tamiflu was deemed to be effective against the swine variant.

"Tamiflu can always be used," she explained, noting that as an antiviral, unlike vaccines, it did not need to be adjusted to specific strains of flu.

The research department at Roche was however looking into dosing schemes, checking to see "how much and for how long," meaning how many pills should be taken and over what period, to achieve maximum effectiveness.

Rupp said Roche had donated in recent years 5 million doses of Tamiflu to the World Health Organisation.

Of these, 2 million were distributed "to stockpiles in countries not yet well prepared" in the developing world. From the remaining doses, the company had 1.5 million doses in Switzerland and an identical amount in the US on standby as a "fire-blanket," to be distributed if needed in case of a pandemic.

"We are waiting for WHO to ask us to deploy," Rupp said, noting that the company had the capacity to ramp up production if that was requested by the international organization. She added that in 2005, the full production capacity was never used.

The WHO was preparing for the second meeting of its International Health Regulation Committee on Tuesday, after having convened one session over the weekend.

A World Health Organization official said on Sunday that the world was better prepared for the current situation of swine flu, owing to steps taken by governments during the avian outbreak, including the stockpiling of needed drugs.
--------------------------------------------------------
I don't know how many such pills are stockpiled, but the talk here of 13 million pills [no doubt there are many multiples more, but there are nearly 7 billion people and one takes this many times, not just once, to be effective!] Is there even enough to even take care of Mexico City? - who are they kidding?!

Just heard the USA only has enough for 20% of the population...hmmm.....great.:elefant: I hope Katrina will not be the 'model' of who gets and who gets not.....

David Guyatt
04-27-2009, 01:08 PM
I have about as much nouse on these things as a cake fairy, but I did notice the following alarum. Whether it has any validity or not I have no idea. Better minds than mine need to enquire.

http://www.tpuc.org/forum/viewtopic.php?f=4&t=1986



Do Not Take A Swine Flu Vaccine!
by paulb on Mon Apr 27, 2009 10:33 am

Do Not Take A
Swine Flu Vaccine!
From Patricia Doyle, PhD
4-25-9

Hello Jeff -

I am making a plea to everyone who reads this, please, please DO NOT TAKE ANY VACCINE THAT IS PURPORTED TO 'PREVENT' THIS FLU.

Remember 1976 and the so called Swine Flu outbreak that was purported to be a coming pandemic? It only infected recruits at Ft. Dix. Why? Because I believe that the so called Swine Flu virus infected the recruits due to the vaccines they were given. Whether the government developed the Swine Flu 1976 virus and infected the recruits as a means to test the public to see if people would comply with a call to take vaccination against Swine Flu, or the recruits became infected via contaminated vaccine they were given as part of the recruit regimen, that outbreak was as phony as they come. I was one of the people duped into taking a Swine Flu shot and it made me so sick. I was sick in bed for three months after taking the vaccine.

Do not take seasonal flu vaccine if you are told that it could help prevent this brand new Swine Flu variant. It won't do a thing to prevent this flu. What it will do is serve up new genetic material to the Swine Flu virus that I have dubbed Spanish Flu 2, the Sequel. The Spanish Flu variant will use the gene sequences in the vaccine in humans to develop more of the changes that make the virus more readily infect humans. We do not want to give this virus more human genetic material so that it will infect humans more readily person to person. This is what vaccinated individuals do for pandemic strains.

There is also a safety issue in any experimental vaccine, much like the one in 1976. Some people even feel that such a vaccine for pandemic strain might require more than one vaccination which could actually be a binary set up. The first shot might just add some genetic code that stays dormant in the body until one gets the second vaccine shot which then serves to only cause infection. It could trigger Guillain-barre syndrome, Typhus or some other condition.

An Influenza vaccine does not protect or prevent a person from contracting flu. It is purported to, maybe, prevent some complications of flu and maybe shorten duration. I am not even sure it does that. Personally, I feel the vaccine weakens our immune system and also sickens us due to contaminants in the vaccine. I feel that people can better protect themselves by washing hands often and thoroughly. People should also use protective gloves when out and about during epidemics. Don't be afraid of "looking odd." I would not be ashamed to use a mask and gloves. I see that the Mexicans are using them.

A big problem during a pandemic is that these simple supplies will become extremely scarce awfully quickly. Stock up now. Medical supplies. personal hygene supplies and don't forget fido, or any other pet. Once a pandemic hits, it will be too late to stock up. Water, too.
We may lose clean water and electric power, so be prepared.

So, please, people, DON'T TAKE ANY VACCINES OFFERED. THEY COULD KILL YOU BEFORE ANY VIRUS KILLS YOU.

Pat Doyle


Patricia A. Doyle DVM, PhD Bus Admin, Tropical Agricultural Economics Univ of West Indies Please visit my "Emerging Diseases" message board at: http://www.emergingdisease.org/phpbb/index.php Also my new website: http://drpdoyle.tripod.com/ Zhan le Devlesa tai sastimasa Go with God and in Good Health

Peter Lemkin
04-27-2009, 02:02 PM
I have about as much nouse on these things as a cake fairy, but I did notice the following alarum. Whether it has any validity or not I have no idea. Better minds than mine need to enquire.

http://www.tpuc.org/forum/viewtopic.php?f=4&t=1986



Do Not Take A Swine Flu Vaccine!
by paulb on Mon Apr 27, 2009 10:33 am

Do Not Take A
Swine Flu Vaccine!
From Patricia Doyle, PhD
4-25-9

Hello Jeff -

I am making a plea to everyone who reads this, please, please DO NOT TAKE ANY VACCINE THAT IS PURPORTED TO 'PREVENT' THIS FLU.

Remember 1976 and the so called Swine Flu outbreak that was purported to be a coming pandemic? It only infected recruits at Ft. Dix. Why? Because I believe that the so called Swine Flu virus infected the recruits due to the vaccines they were given. Whether the government developed the Swine Flu 1976 virus and infected the recruits as a means to test the public to see if people would comply with a call to take vaccination against Swine Flu, or the recruits became infected via contaminated vaccine they were given as part of the recruit regimen, that outbreak was as phony as they come. I was one of the people duped into taking a Swine Flu shot and it made me so sick. I was sick in bed for three months after taking the vaccine.

Do not take seasonal flu vaccine if you are told that it could help prevent this brand new Swine Flu variant. It won't do a thing to prevent this flu. What it will do is serve up new genetic material to the Swine Flu virus that I have dubbed Spanish Flu 2, the Sequel. The Spanish Flu variant will use the gene sequences in the vaccine in humans to develop more of the changes that make the virus more readily infect humans. We do not want to give this virus more human genetic material so that it will infect humans more readily person to person. This is what vaccinated individuals do for pandemic strains.

There is also a safety issue in any experimental vaccine, much like the one in 1976. Some people even feel that such a vaccine for pandemic strain might require more than one vaccination which could actually be a binary set up. The first shot might just add some genetic code that stays dormant in the body until one gets the second vaccine shot which then serves to only cause infection. It could trigger Guillain-barre syndrome, Typhus or some other condition.

An Influenza vaccine does not protect or prevent a person from contracting flu. It is purported to, maybe, prevent some complications of flu and maybe shorten duration. I am not even sure it does that. Personally, I feel the vaccine weakens our immune system and also sickens us due to contaminants in the vaccine. I feel that people can better protect themselves by washing hands often and thoroughly. People should also use protective gloves when out and about during epidemics. Don't be afraid of "looking odd." I would not be ashamed to use a mask and gloves. I see that the Mexicans are using them.

A big problem during a pandemic is that these simple supplies will become extremely scarce awfully quickly. Stock up now. Medical supplies. personal hygene supplies and don't forget fido, or any other pet. Once a pandemic hits, it will be too late to stock up. Water, too.
We may lose clean water and electric power, so be prepared.

So, please, people, DON'T TAKE ANY VACCINES OFFERED. THEY COULD KILL YOU BEFORE ANY VIRUS KILLS YOU.

Pat Doyle


Patricia A. Doyle DVM, PhD Bus Admin, Tropical Agricultural Economics Univ of West Indies Please visit my "Emerging Diseases" message board at: http://www.emergingdisease.org/phpbb/index.php Also my new website: http://drpdoyle.tripod.com/ Zhan le Devlesa tai sastimasa Go with God and in Good Health

She raises some real and possible issues of concern. I'll try to research the specifics and get back soon on this. I do remember in my Public Health training reading about persons who got influenza and influenza-like diseases from vacines and there have been many flu and other such cases especially among the military, who often forces soldiers to take multiple shots and some very experimental vacines, at that. Remember however she has a DVM degree and I'd rather trust a PhD in virology from a private university who is not under government contracts.

Meanwhile...
it is now in Europe too: Spain reports three suspected cases of swine flu
4/26/2009 18:34:39 by TaraP 7 replies 494+ views
http://news.xinhuanet.com/english/2009-04/27/content_11262784.htm ^ | April 27th, 2009
MADRID, April 26 (Xinhua) -- Spanish Health Minister Trinidad Jimenez said on Sunday that three Spanish nationals had developed symptoms similar to swine flu a few days after they returned from a Mexico trip. Currently, the three were placed in isolation and treated at different hospitals, said Jimenez. They were in stable conditions, but it is unclear if they were indeed infected with swine flue and medical personnel are analyzing their cases to come up with definite diagnosis as soon as possible, she added. The three came from the northern city of Bilbao, Almansa in the southeast.
------------------------------------------
I'd suggest anyone worried get some fine-filter face masks, some comfortable surgical gloves and lots of liquid surgical disinfectant for hand cleaning and cleaning of surfaces. The flu shots and medicines should only be used at the last moment, if needed and under the advice of a trusted doctor - or two. I've not heard of side-effects of Tamiflu, but that doen't mean there aren't any. Flu shots have been, at times, the cause more than the cure...but in a life and death risk situation it can come down to a hobsons choice and difficult decision for the layman.---------------

Perhaps unrelated, but.....

Military Industrial Complex Prepares Mass Graves for U.S. Citizens
http://www.infowars.com/military-industrial-complex-prepares-mass-graves-for-us-citizens/
March 25, 2009

A usually quiet U.S. Department of Veterans Affairs Cemetery, has been unusually active lately. The National Memorial Cemetery of Arizona is a beautiful 225 acre facility located in Phoenix.

For the past 30-45 days in the early hours of the morning until sunset, a massive construction operation has been underway. Major amounts of earth have been excavated out about 9-10 feet deep and 600-1000 feet wide. There is multiple locations on the property like this. From the satellite view there appears to be more sections that have been covered with the concrete lids and backfilled to look as if nothing is there. ABC rock is put in place under the burial vaults for good drainage and solid bedding. This will help not contaminate ground water sources from decomposition of human bodies.

The cleanliness of the heavy equipment operation and the large perfect cuts of earth is im pressive. These Massive concrete boxes are transported from a nearby storage yard on various privately owned flatbed semi-trucks, then unloaded and put into place a half mile away at the actual mass grave site. They are installed tight together side by side with no space in between.

An interview was conducted between my friend and a truck driver involved in this operation. After beating around the bush for ten minutes, the driver admitted I got paid a whole lot of money to speak good english. Take it for what its worth but that sounds suspect. The truck driver also admitted Each burial vault holds four caskets.
I took note that if caskets were not used you could fit 40 bodies or more in each one.

So if these were to hold four troops each and the truck driver did know what he was talking about; this would mean that there are plans in advance for over 4000 U.S. soldiers deaths.

If these are not to contain caskets and only bodies are inserted there could be room for over 40,000 civilians bodies.

See additional photos: photo 1, photo 2, photo 3, photo 4.

The latest figures suggest that the number of deaths and number of people admitted to hospital from what is believed to be swine flu continue to increase by about 25 per cent every day.

Peter Lemkin
04-27-2009, 04:18 PM
150 dead in Mexico

and 30 suspected cases in Spain.....50 in the USA 10 in the UK....3 in Germany, Several in NZ and Canada.............more than 20,000 people in Europe have come from Mexico City and other places the virus had infected recently.

......time for me to buy masks before the weekend even though most who have died are (strangely) between 20-40. Symptoms from those seriously ill include high fever, headache, eye pain, shortness of breath and extreme fatigue with rapid progression of symptoms to severe respiratory distress in about five days.

it is picking-up speed................

Not connected, but Mexico has enough problems...and the coincidences are really getting amazing....just reported they had an earthquake - 6 on Richter Scale - in Mexico City!

Jan Klimkowski
04-27-2009, 08:22 PM
There are many very concerning aspects to what MSM is now calling "Mexican Swine Fever/Flu".

However the response of nation states to an infectious, potentially fatal, "virus" is well known from documents leaked from almost every major government in the world.

That response includes:

i) enforced quarantine of "infected areas" through police/military patrolled rings of steel. Drugs will be airdropped and those inside the quarantine zone will be subject to a survival of the fittest ordeal: both in terms of their medical health, and because there will be zero law and order inside the quarantine zone;

ii) complete governmental control over the media on grounds of national security, combined with highly constrained freedom of movement for civilians outside the enforced quarantine zone.

A global pandemic has always been near the top of my list of Their potential wildcards to preserve Their wealth and power through the coming collapse of the global financial system.

Jan Klimkowski
04-27-2009, 09:11 PM
Given that young people are dying from this flu strain, it may be producing a so-called cytokine storm.

This is another good reason not to take Rumsfeld's poision, if it's offered to you.


A cytokine storm is a potentially fatal immune reaction consisting of a positive feedback loop between cytokines and immune cells, with highly elevated levels of various cytokines.[1]

Symptoms
The primary symptoms of a cytokine storm are high fever, swelling and redness, extreme fatigue, and nausea.

Cause
When the immune system is fighting pathogens, cytokines signal immune cells such as T-cells and macrophages to travel to the site of infection. In addition, cytokines activate those cells, stimulating them to produce more cytokines. Normally, this feedback loop is kept in check by the body. However, in some instances, the reaction becomes uncontrolled, and too many immune cells are activated in a single place. The precise reason for this is not entirely understood but may be caused by an exaggerated response when the immune system encounters a new and highly pathogenic invader. Cytokine storms have potential to do significant damage to body tissues and organs.[citation needed] If a cytokine storm occurs in the lungs, for example, fluids and immune cells such as macrophages may accumulate and eventually block off the airways, potentially resulting in death.[citation needed]

The cytokine storm (hypercytokinemia) is the systemic expression of a healthy and vigorous immune system resulting in the release of more than 150 inflammatory mediators (cytokines, oxygen free radicals, and coagulation factors).[citation needed] Both pro-inflammatory cytokines (such as Tumor necrosis factor-alpha, Interleukin-1, and Interleukin-6) and anti-inflammatory cytokines (such as interleukin 10 and interleukin 1 receptor antagonist) are elevated in the serum of patients experiencing a cytokine storm.[citation needed]

Cytokine storms can occur in a number of infectious and non-infectious diseases including graft versus host disease (GVHD), adult respiratory distress syndrome (ARDS), sepsis, avian influenza, smallpox, and systemic inflammatory response syndrome (SIRS).[2]

The first reference to the term cytokine storm in the published medical literature appears to be by Ferrara et al.[3] in GVHD in February 1993.

Role in pandemic deaths
It is believed that cytokine storms were responsible for many of the deaths during the 1918 influenza pandemic, which killed a disproportionate number of young adults.[1] In this case, a healthy immune system may have been a liability rather than an asset. Preliminary research results from Hong Kong also indicated this as the probable reason for many deaths during the SARS epidemic in 2003.[citation needed] Human deaths from the bird flu H5N1 usually involve cytokine storms as well.[citation needed] Recent reports of high mortality among healthy young adults in the 2009 swine flu outbreak point to cytokine storms as being responsible for these deaths.[4]

http://en.wikipedia.org/wiki/Cytokine_storm

Bruce Clemens
04-27-2009, 11:38 PM
The following from:
http://whatreallyhappened.com/WRHARTICLES/deadbiologists.html

The mysterious deaths of top microbiologists

It all began with Don Wiley. On November 15th, Harvard Professor Don Wiley left a gathering of friends and colleagues some time after 10:30 PM. The next morning, Memphis police found his rental car stopped on a bridge, with a full tank of gas and keys still in the ignition. There was no financial or family trouble. Indeed Wiley was supposed to meet his family at the Memphis airport to continue on to an Icelandic vacation. Neither was there any history of depression or mental illness.

In the report printed in the New York Times on November 27th, the FBI's Memphis office distanced itself from the case saying that the available facts did not add up to a suspicion of foul play. I guess at the FBI it's a perfectly everyday occurrence for a Harvard Professor to stop his rental car on a bridge in the middle of the night before he is supposed to leave for Iceland and just walk away into the Tennessee dark.

The NYT report of November 27th also downplayed Professor Wiley's expertise in virology, quoting Gregory Verdine, a professor of chemical biology at Harvard, said, "If bioterrorists were to abduct Don Wiley, they'd be very disappointed," because his research was in studying the component parts of viruses, and "that doesn't really help you make a more dangerous version of the virus."

But this statement is not consistent with the facts of Professor Wiley's full range of knowledge. Wiley has, in conjunction with another Harvard Professor, Dr. Jack Strominger, won several academic prizes for their work in immunology, including a Lasker prize. Don Wiley is a Harvard professor, but he is also a researcher at the Howard Hughes Medical Institute, and the National Institute of Health. The Howard Hughes Medical Institute is located in Chevy Chase, Maryland, and performs biological research, sometimes jointly funded by the Department of Defense and the NIH. Don Wiley's peers at Harvard include professors such as John Collier performing research on Anthrax.

So, contrary to the dismissive tone of the New York Times report, Professor Wiley would be of great value to anyone developing biological weapons. This makes the FBI's obvious disinterest in the case highly questionable, indeed reminiscent of the FBI's obvious disinterest in the numerous witnesses in Oklahoma City who had seen Tim McVeigh in the company of additional perpetrators not to mention the witnesses who had seen additional bombs (http://whatreallyhappened.com/WRHARTICLES/RANCHO/POLITICS/OK/bombs/bombs.html).

Especially in light of the events of 9/11, the vanishing of a scientist with Professor Wiley's expertise in virology and immunology should have been expected to be an issue of critical national importance, yet the official tone of the government was that this is nothing to worry about. Move along citizen, nothing to see.

In the context of the Anthrax letters being sent through the mail, any disappearance of any microbiologist under questionable circumstances should have set off alarm bells across the nation. but it didn't. Professor Wiley was assumed to have committed suicide, end of story.

The professor's colleagues expressed doubts about the official "suicide" explanation for his disappearance (http://www.thecrimson.com/article.aspx?ref=160940).

Then, more biologists started to die under suspicious circumstances.

The Very Mysterious Deaths of Five Microbiologists (http://www.rense.com/general18/five.htm).

The body count of infections disease experts continued to climb. Connections to weapons research began to surface.

As many as 14 world-class microbiologists died between 9/11/1 and 3/2/2 (http://www.rense.com/general20/mic.htm), and on 6/24/2 yet another microbiologist was added to the list (http://9news.com/storyfull.asp?id=1519).

Still the US Government acted as if nothing was amiss, as silent on the question of dead microbiologists as they are on the question of the Israeli spies and their connection to 9-11 (http://whatreallyhappened.com/WRHARTICLES/spyring.html).

In fact, the official silence on the question of how so many top experts in infectious diseases could die in such a short time span is deafening.
Now, statistically, it's possible, even likely, that one or two of these microbiologists legitimately were killed in random accidents. But for so many to die in such a short while exceeds all reasonable bounds of statistics.

Prudence would demand an investigation, not the "ho hum" attitude of the government which even today continues to issue dire warnings to the general population of how much we are all in danger from "bioterrorism".

So, let's take a moment and step away from the perpetual fear-mongering of the media (and Rumsfeld) as they assure us another attack IS coming (with a certainty which suggests inside information on the subject) and assume for a moment that some party has indeed decided to "liquidate" weapons research infectious disease experts.

There is really only one reason to kill off a bunch of scientists. To keep them from doing something they are able to do.
What were these scientists able to do? Maybe blow the whistle if an artificially created disease was about to be used in a manner those who created it did not approve of. (http://www.africa2000.com/SNDX/nssm200all.html)

Regardless of the exact reason, there does seem to be a clear pattern of targeted microbiologists, and paired with it, an obvious government disinterest in the matter.
I leave it to you to figure out why.

See also:
Dead Scientists And Microbiologists - Master List
(http://rense.com/general62/list.htm)Anthrax and 9/11 - Index of What Really Happened (http://whatreallyhappened.com/WRHARTICLES/anthrax_9-11_index.html)

Peter Lemkin
04-28-2009, 10:43 AM
Add Israel to the list. It now seems likely that large, unsanitary, crowded (and cruel) commercial pig-farms might be responsible - if this is a natural (sic) event. Another reason to consider promotion of vegetarianism or, at least, free-range animals. The Avian flu was coming from the similar commercial chicken farms in SEA. Anyway you look at it humans and their overpopulation, domination and industrialization/corporatization of the Planet is destroying everything and may soon consume us all. Mad cow disease (caused by a prion, not a virus) was spread and impelled by crowded commercial cow herds. This planet needs to rid itself of the human plague, unless we return to the Natural fold and sustainability. See my thread in Environment on Jensen. He is calling for the immediate dismantling of 'civilization'. (http://www.deeppoliticsforum.com/forums/showthread.php?t=401) [The Deep Political 'stuff' would also play in to this view, in the dismantling of empire(s), the domination paradigm and a return to neo-tribalism......]

Someone seems to be cooking the Mexico books on cases [likely to avoid panic] as the numbers of dead have not increased in 24 hours - nearly an impossibility.

Magda Hassan
04-28-2009, 02:40 PM
In Mexico, state health authorities looking for the initial source of the outbreak toured a million-pig hog farm in Perote, in Veracruz State. The plant is half-owned by Smithfield Foods, an American company and the world's largest pork producer. Mexico's first known swine flu case, which was later confirmed, was from Perote, according to Health Minister Jos? ?ngel C?rdova. The case involved a 5-year-old boy who recovered.But a spokesman for the plant said the boy was not related to a plant worker, that none of its workers were sick and that its hogs were vaccinated against flu.
The Smithfield Virus?

From the NY Times today's edition I think. Sorry lost the link.

Apparently there are 15 cases in Australia now. Or was that NSW?

They could ban all travel for every one except for medical reasons and that would stop the spread. But won't the business crowd scream about that? Can't interfere with profits.

David Guyatt
04-28-2009, 04:10 PM
I have to say that I am watching the media's possible but always profitable panic, er, pandemic with considerable cynicism.

Bruce Clemens
04-29-2009, 12:30 AM
Oddly enough, USA's National Public Radio, usually a bastion of the official line, this evening presented some ugly historical facts about flu vaccinations:

http://www.npr.org/templates/story/story.php?storyId=103582555

Bruce Clemens
04-29-2009, 01:55 AM
Seen here:

http://www.foxnews.com/politics/first100days/2009/04/28/officials-offer-new-swine-flu/

My analysis:

H1N1s now the name of the flu,
because sellin pork is what we must do.
Its not all about the people who are dyin
Its really about companies sellin swine.
Swine Flu is so out; H1N1's so in,
the result of our Homeland Securitys spin.

So if you get sniffles, sore throat and some coughin,
dont use that piggy name that we've heard so often.

Instead use the consonants and numbers prescriptive,
that will save the economy of corporations, pork addictive.
I leave it to you which will win out in the press,
Napolitanos H1N1 or Swine Flu?

Its your guess.

Magda Hassan
04-29-2009, 02:58 AM
:hahaha:

Peter Lemkin
04-30-2009, 05:03 AM
I've been following this story carefully. While I don't discount the posts above that hint [or more than hint] of possible anthropogenic or sinister cause(s) of this disease, or the media and PTB using it to further terrify the Public, profit, etc. Whatever the cause and irregardless of the hype and fearmongering it is a very real danger now. It is very clearly now being transmitted easily person to person, and no one has prior immunity. A few students in New York who had just returned from Mexico City developed this flu upon return and now most of their entire school have flu-like symptoms. The same is starting to happen worldwide. The only unknown now is how virulent it will be. My prediction, being trained in Public Health, is the WHO call is correct and there is a much better than even chance this will accelerate and spread widely to worldwide in the next few weeks, as did the 'Spanish Flu' in 1918. Then there were, I believe, 40,000,000 dead recorded. If this is virulent the death toll will be far greater, if not too virulent [let us hope!] far less. Thus far most cases out of Mexico have not been lethal, but now there are some recorded deaths outside of Mexico. It is a very bad situation. :afraid: This will also deal an economic blow worldwide, on top of the bankers/financiers war on the rest of us.

This is now a very serious threat, and [I]one way or the other yet another sign of humans living a 'life out of balance' - Koyaanisqatsi (http://video.google.com/videoplay?docid=5539613947839465921)

* The "NAFTA Flu": Critics Say Swine Flu Has Roots in Forcing Poor Countries to Accept Western Agribusiness *
Professor and author Robert Wallace says the swine flu is partly the outcome of neoliberal policies that forced poorer countries to open their markets to poorly regulated Western agribusiness giants.
http://www.democracynow.org/2009/4/29/the_nafta_flu

Bruce Clemens
04-30-2009, 12:26 PM
Why have flu deaths been confined only to people of Hispanic origin?

This is turning out to be the seminal document to understanding our world today- It's the one that, in 2000, called for a "New Pearl Harbor" to galvanize Americans to accept a NWO of U.S. hegemony. What else within this document may come true???

http://www.newamericancentury.org/RebuildingAmericasDefenses.pdf

on page 60:

...And advanced forms of biological warfare
that can target specific genotypes may
transform biological warfare from the realm
of terror to a politically useful tool.

Magda Hassan
04-30-2009, 12:30 PM
Why have flu deaths been confined only to people of Hispanic origin?
Bruce, does this apply to the deaths outside of Mexico too? I heard there are one or two deaths now in the US. Were these Latinos?

Bruce Clemens
04-30-2009, 12:40 PM
Yes, Magda. The one death in the USA that I am aware of was a Mexican toddler who was brought across the border after he became sick.

Peter Lemkin
04-30-2009, 06:30 PM
Why have flu deaths been confined only to people of Hispanic origin?

This is turning out to be the seminal document to understanding our world today- It's the one that, in 2000, called for a "New Pearl Harbor" to galvanize Americans to accept a NWO of U.S. hegemony. What else within this document may come true???

http://www.newamericancentury.org/RebuildingAmericasDefenses.pdf

on page 60:

...And advanced forms of biological warfare
that can target specific genotypes may
transform biological warfare from the realm
of terror to a politically useful tool.

Yes, they have been trying this for a long time. Even back just after the Civil War they were looking for diseases just for African-Americans. The Nazis then were quite interested in this. Now, they try to exploit the very tiny genetic difference clusterings in one population from another (http://www.prisonplanet.com/is-swine-flu-a-race-specific-virus.html)[since we all are the same 'race']. Officially, this has not yet been developed. They even hope some day to have designer diseases tailored for a tribe, family of just one person - it could be you!.....ah, the wonders of technology and science!.....:hello::bootyshake::hello:

Jan Klimkowski
04-30-2009, 06:57 PM
I was encouraged to include my post #7 in the thread below, in this thread:

http://www.deeppoliticsforum.com/forums/showthread.php?t=1359

So, here it is:


In addition, 1977 news accounts cited intelligence sources who claimed that in 1971 U.S. intelligence agents brought Swine flu from Fort Gulick (Espinar) in Panama to Cuba, where the flu apparently contaminated a large number of pigs. The United Nations Food and Agriculture Organization called the epidemic of swine flu that hit Cuba in 1971 the "most alarming event" of that year. According to the accounts, an intelligence agent was given a sealed unmarked container and instructed to deliver it to an anti-Castro group in Panama. Cuban exiles interviewed for the report said they received the container off Bocas del Toro in Panama and brought it to contacts to the small island of Navassa, whence it was shipped to Cuba in late March 1971. The first Cuban pigs contracted the flu on about May 6.106 Cuban authorities slaughtered half a million pigs in order to contain the epidemic.107


107 Alexander Cockburn, "From Pearls...", The Nation, March 9, 1998, p. 9.

This suggests that swine flu has been weaponized by classified military CBW programmes for almost four decades...

FWIW

Bruce Clemens
04-30-2009, 07:09 PM
Yes, they have been trying this for a long time. Even back just after the Civil War they were looking for diseases just for African-Americans.

And let's not forget- A biological weapon targeted to a specific race was actually accomplished in the U.S. in the late 1800s.
Albiet the exploit was that one race had immunity while the targeted race did not:

Smallpox infected blankets were given to Native Americans by the government.

They did it once, why not again?

Jack White
04-30-2009, 08:54 PM
Let's not leave out AIDS, which targeted blacks, homosexuals and Africans.

Jack

Bruce Clemens
05-01-2009, 03:19 AM
Malaria death statistics by worldwide region:

About 1,136,000 deaths from malaria in Africa 2002 (The World Health Report, WHO, 2004)
About 1,000 deaths from malaria in The Americas 2002 (The World Health Report, WHO, 2004)
About 65,000 deaths from malaria in South East Asia 2002 (The World Health Report, WHO, 2004)
About 2,000 deaths from malaria in Europe 2002 (The World Health Report, WHO, 2004)
About 57,000 deaths from malaria in Eastern Mediterranean 2002 (The World Health Report, WHO, 2004)
About 11,000 deaths from malaria in Western Pacific 2002 (The World Health Report, WHO, 2004)

This goes on year after year. If these numbers were attributed to this "swine flu", do you think we'd be only at CDC Level 5 ?

My point is that whatever this "flu" is, it really is just a blip on the radar of all the things that constantly assault human beings on this planet. Is it a beta-test of a race specific bioweapon? Maybe. But is it going to require a draconian change in government's role in our lives to allow us to deal with it? Undoubtedly.

Look at the data above about Malaria. This current "Pandemic" has a loooong way to go before it even approaches the carnage caused by germs we all face every year. So I wonder if this is just a limited, natural event or a "Beta Test" that is being managed and monitored to see how "We The People" react to yet another massive push by government to take over our lives. If it is the former, it could certainly still be exploited by Government to its ends. If it is the latter, well, we have enough historical precedent to help us deal with the horror of the thought. It's happened before and we know it. Either way we are left with a very mysterious disease that, in the grand scheme of things, seems intended to get government more power over you.

Myra Bronstein
05-01-2009, 03:42 AM
This one is very suspicious, as it has DNA portions from pigs, birds and humans all together. It could happen naturally, but the odds are slim.

This is what I find quite incredible too. What are the chances of this happening in real life? It's up there with the Crisman - Bannister encounters in queerness.

Yup. This may have happened naturally. However it seems to have crossed two species barriers and caused a significant number of human deaths before the WHO, CDC etc have gone public.

Crisman & Banister were involved in deep black psyops & covert ops.


It is only a matter of time before there is an influenza outbreak whether by design or naturally occurring circumstances. What is known is that Donald Rumsfeld and others will be making a packet as they have shares in the pharmaceutical compnay, Gilead, that makes Tamiflu which is said to be the most effective drug against this strain. Though its rate of effectiveness is still quite low actually. IIRC

http://www.snopes.com/politics/medical/tamiflu.asp

Precisely. Absolutely crucial context.

...

Yes it is.
It will be interesting to see if Rumsfeld reaps a pandemic of profit.

Meanwhile, this Salon article about a past flu "scare" is pretty hilarious: http://www.salon.com/env/feature/2009/04/28/1976_swine_flu/

Magda Hassan
05-04-2009, 01:40 PM
What is with the undead in Mexico? There are now only 25 confirmed deaths in Mexico from the swine flu. It was up to something like 150 a few days ago wasn't it? Are people being brought back to life by the miracles of modern science or were they not dead in the first place even though they were, or at least were said to be dead. Rubbery figures. Good for the share price though. Also where are the interviews with the grieving families? (or those in celebration for the return from the dead for that matter)

Peter Lemkin
05-04-2009, 01:57 PM
What is with the undead in Mexico? There are now only 25 confirmed deaths in Mexico from the swine flu. It was up to something like 150 a few days ago wasn't it? Are people being brought back to life by the miracles of modern science or were they not dead in the first place even though they were, or at least were said to be dead. Rubbery figures. Good for the share price though. Also where are the interviews with the grieving families? (or those in celebration for the return from the dead for that matter)

In part it is a matter of definition. The 159+ dead in Mexico is real...but only 25 dead confirmed [thus far] as having died of the swine-avian-flu; so....if they died of something else, what was it. Tosh posted an interesting thread speaking of a kind of pneumonia. Very odd things going on. Around the world now there are over 500 confired flu cases, but almost none have died from it....it will take some time to make sense of this all.

Jan Klimkowski
05-04-2009, 08:10 PM
There's a hint of Monty Python to the following "scientific" article in the New York Times.

However, trying to ignore the Pythonesque elements, it may include important clues as to the genesis of this so-called swine flu:


Viruss Tangled Genes Straddle Continents, Raising a Mystery About Its Origins


By DONALD G. McNEIL Jr.
Published: April 30, 2009

The flu that is moving through humans appears to have a combination of genes from two normally separate sets of pigs, those from the Americas and from Eurasia, scientists say.

However, it is unknown how those pigs met, and there is not yet any genetic proof that this particular flu was ever in a pig.

And, despite current fears, some geneticists feel this strain may not be very deadly. As it circulates in humans, however, especially in the Southern Hemisphere winter, it could pick up dangerous human flu genes.

The only way to be sure, they say, is to wait and see. But world health authorities hope to have a vaccine soon that will put a stop to the flus circulation.

The first conundrum a swine-type virus that has not yet been found in swine is readily explained, scientists said. It was first identified in humans just last week, when Canadian and American authorities realized that the flus they had sequenced from sick people in California, Texas and Mexico were the same. No one ever tested pigs for it before, and those tests are just getting under way.

Such quirks are common in disease genetics. In the 1980s, for example, it was not known that the AIDS virus was sweeping Africa because the illness was first found in a few gay men in California, and it took years to find the source virus in chimpanzees.

Now, scientists say, the hunt is on for what is jokingly being called Pig Zero.

No one that Im aware of has swabbed pigs for this yet, Dr. Juan Lubroth, chief of veterinary investigations for the United Nations Food and Agricultural Organization, said Wednesday.

An international team, including Dr. Lubroths investigators and some from the World Organization for Animal Health, is in Mexico, planning to go to La Gloria, the location of the first known case involving a human, 5-year-old dgar Hernndez.

Mexican investigators have already visually inspected herds of pigs at the vast factory farms there, Dr. Lubroth said. But a flu strain that sickens humans may not bother pigs, just as the H5N1 avian flu kills chickens but usually not ducks.

It will take some time to swab the pigs snouts, fly the samples to a world-class laboratory and sequence it. And even then, Dr. Lubroth said, the La Gloria pigs may not be the key, so his team will scour Mexicos library of routine swine swabs for matches. The only viral sequences on public databases thus far are human.

The federal Centers for Disease Control and Prevention announced last week that the new virus had pieces of North American swine, bird and human flus and of Eurasian swine flu. Although rumors questioning that are circulating on the Internet, most geneticists believe it is correct.

It is essentially a blend of Eurasian swine flu and North American swine flu, but Western hemisphere strains have had an avian segment on the PB2 gene for at least 10 years and a human component on the PB1 gene since 1993, said Henry L. Niman, a biochemist who tracks flu mutations. The original report is correct, Dr. Niman said of the C.D.C.s analysis. The rumors, he added in an e-mail message, stem from someone who really doesnt know how to analyze sequences (or is being misquoted.)

It presumably is in pigs somewhere, perhaps in Mexico. The 1918 human H1N1 established itself in pigs by 1930. But, as Dr. Niman pointed out, it could be only in humans now or even in a ferret.

The next question, said Dr. Robert G. Webster, a virologist at St. Jude Childrens Research Hospital, is: How did this virus get in? Is Mexico importing swine from Europe?

While movement of live pigs between Canada, the United States and Mexico for fattening and slaughter is routine, legal movement of pigs across oceans is rare. Pigs carry many diseases, so importation requires expensive tests and quarantines. The only reason to bother would be for breeding, not meat.

Even pig semen is restricted, said Kent Parker, swine facility manager at the University of California, Davis. The boars have to be tested and the facility they live in has to be authorized, Mr. Parker said. Frozen semen can transmit blue-ear pig disease, he said. It cannot transmit flu, said a spokeswoman for the National Pork Board.

Peter Daszak, president of the Wildlife Trust, found records showing that Mexico imported two pigs from France in 2007, the United States imported a few from Britain and Ireland, and Canada imported hundreds from Europe. And surely this isnt the whole truth, he said. There must be a hidden illegal trade.

While some scientists looking at the virus genome debated its origin, Peter Palese, chairman of microbiology at Mt. Sinai School of Medicine, found cause for optimism about the future. All the pandemic viruses of the last century the 1918, 1957 and 1968 flus had a mutation in the gene coding for a protein known as PB1-F2 that is thought to make a virus more lethal. The mutation, he said, is not in the new strain.

Dr. Niman, looking at the same sequences, saw a mutation that, at the same position in H5N1, appeared to speed the viruss spread in Egypt.

Gardiner Harris contributed reporting from Washington.


http://www.nytimes.com/2009/05/01/health/01origin.html?_r=1

Magda Hassan
05-05-2009, 01:41 AM
Is this the first verified case of pigs flying?

Myra Bronstein
05-05-2009, 03:30 AM
Is this the first verified case of pigs flying?

:hahaha:

David Guyatt
05-05-2009, 10:02 AM
Clearly this was not a pandemic. It was not even close to an average common or garden flu season. It was a small - actually tiny - bubble that couldn't be sustained (not enough deaths) and thus quickly burst under its own atmospheric pressure.

So why was the world placed on such high alert? And why did governments and the media (in the UK anyway) discuss mass graves, thousands of deaths daily, area quarantines and mass vaccinations?

It seems to me that we are not being told the truth or have been sold a pile of BS -- possibly both.

Bruce Clemens
05-05-2009, 11:47 AM
...and the fact that only Hispanics died? Will that be conveniently forgotten as the media moves on to other things? Will that fact be the WTC 7 of this event?

David Guyatt
05-05-2009, 12:21 PM
Regarding your comments Bruce, I most cautiously mention the fact - first brought to light by Michael Riconosciuto - about "race specific" bio-weapons. He helped develop them for the US he claimed, and many years later the Israeli's were said in a newspaper article to also have developed them.

Jan Klimkowski
05-05-2009, 05:39 PM
Is this the first verified case of pigs flying?

:marchmellow:

I think that flying pig came from the dark side of the moon...


Clearly this was not a pandemic. It was not even close to an average common or garden flu season. It was a small - actually tiny - bubble that couldn't be sustained (not enough deaths) and thus quickly burst under its own atmospheric pressure.

So why was the world placed on such high alert? And why did governments and the media (in the UK anyway) discuss mass graves, thousands of deaths daily, area quarantines and mass vaccinations?

It seems to me that we are not being told the truth or have been sold a pile of BS -- possibly both.

It could have been probing at the defences in many senses.

Personally, I'd quite like to have had a dose of this Mark 1 "Swine Flu". If it comes back in a mutated form (whether thanks to Nature or deep black Nurture), it will also certainly be more lethal. And those individuals who've had, and survived, the relatively mild version will be potential Omega Men....

Bruce Clemens
05-05-2009, 10:24 PM
Ok, this is the sinister side of me thinking...

The behavior of this "flu" might represent the successful outcome of a field-test of a gene-specific bio weapon.

I mean consider: Extremely virulent and deadly within a select group of people, doing its damage and then quickly expanding, losing potency out from the epicenter like a bomb blast until it is all but innocuous in the greater population. Only lethal to the target population, easily defended against by all others. Kills primarily young, vigorous "targets".

Perhaps, somewhere in the world, there is a group of people congratulating themselves right now for a job well done...and looking forward to expanding the trial.

Bruce Clemens
05-06-2009, 03:01 AM
I just can't find ANY more details in the MSM...

(Newser) Texas health officials said today that a US woman who lived near the Mexico border has died from swine fluthe second death in the nation and first of a US resident, USA Today reports. The news, however, comes amid continued confidence that the H1N1 virus remains relatively mild here, and the Centers for Disease Control reversed guidelines saying that schools should close if they have suspected or confirmed cases.
Few details were available about the Texas womans death, except that she had chronic health problems beyond the flu. Meanwhile, CDC acting chief Richard Besser said schools no longer need to shut down for two weeks when cases emerge. He said, however, that parents should continue to keep an eye on their kids and keep them home if they show symptoms.
Source: USA Today (http://www.usatoday.com/news/health/2009-05-05-swine-flu_N.htm)

David Guyatt
05-06-2009, 08:42 AM
http://news.bbc.co.uk/1/hi/world/americas/8034991.stm

US navy halts aid vessel over flu
The US navy is postponing an aid mission to the South Pacific after a sailor on the vessel scheduled to take the trip developed swine flu.

Nearly 50 others sailors on the California-based USS Dubuque also showed symptoms of the new H1N1 virus.

A US Navy spokesman said officials would be looking at other alternatives to meet the mission's objectives.

Earlier, a woman from Texas become the first US resident believed to have died from swine flu.

The woman - from Cameron County, close to the US border with Mexico - died earlier this week, the Texas Department of State Health Services (DSHS) said.

CONFIRMED CASES
Mexico: 101 suspected deaths - 29 confirmed; 840 confirmed cases
US: Two deaths, 403 confirmed cases
Canada: 140 confirmed cases
Spain: 57 confirmed cases
UK: 27 confirmed cases
But in a statement it added that she had been suffering "chronic underlying health conditions".

Lt Cmdr John Daniels said the navy was using "using prudent judgment" in cancelling the deployment of the USS Dubuque.

The amphibious transport vessel normally carries more than 400 crew and about 900 Marines.

It had been due to depart in early June for Samoa, the Solomon Islands, Tonga, Kiribati and the Marshall Islands as part of America's Pacific Partnership humanitarian programme.

Lt Daniels said the mission would still go ahead at some point but the USS Dubuque would no longer be part of it.

Navy Lt Sean Robertson said ill crew members had been treated with anti-viral medication and the remaining crew had been given prophylaxis.

'Catching up'

The unnamed woman who died in Texas was in her 30s and had recently given birth, reported Associated Press news agency.

Leonel Lopez, Cameron County epidemiologist said the flu itself was "very benign" but had exacerbated her underlying medical problems.

The woman becomes the second confirmed person to have died from swine flu outside Mexico. A Mexican toddler died of the virus in the US in April.

There are 61 confirmed cases of H1N1 flu reported in Texas, said the DSHS.

The World Health Organization (WHO) said earlier that 1,490 swine flu cases had been verified in 21 countries.

After Mexico, the US has seen the greatest number of laboratory-confirmed infections, at 403.

US Health Secretary Kathleen Sebelius acknowledged that the virus would continue to spread in the United States and elsewhere in the world, and more deaths would follow.

The WHO has urged nations to remain vigilant in spite of the apparently relatively mild nature of swine flu, saying a global pandemic remains a threat.

It points out that the number of infections has continued to grow worldwide.

Magda Hassan
07-01-2009, 04:12 AM
http://www.russiatoday.com/Top_News/2009-06-25/Is_swine_flu_US-made.html

Wayne Madsen, an American investigative journalist, who claims that swine flu strains have been engineered in two universities in the US and Canada, says they've been deliberately designed to resist vaccines.

Wayne Madsen also says that his so-called nightmare scenario, in which swine flu could mutate with bird flu, has been suppressed by the World Health Organisation for political reasons.
These would increase sales for new vaccines manufactured by the pharmaceutical industry, Madsen said.

Peter Lemkin
07-01-2009, 05:57 AM
There were reports on the BBC that over 1 million Americans have contracted the disease, which has a low death rate...but I wonder what esle it can do 'silently'......

Jan Klimkowski
07-02-2009, 05:42 PM
100,000 swine flu cases a day in the UK by the end of August, so the authorities aren't going to bother counting....

As Corporal Jones in Dad's Army would say: "Don't panic!"


UK swine flu can no longer be contained

Government moves to 'treatment phase' as health secretary says infection rate could reach 100,000 a day by end of August

David Batty and Severin Carrell guardian.co.uk, Thursday 2 July 2009 15.40 BST Article history

Swine flu is spreading so rapidly across Britain that there could be 100,000 new cases a day by the end of next month, the health secretary, Andy Burnham, said today.

The UK would immediately move to the "treatment phase" of its plan to combat swine flu, meaning doctors would no longer test for the H1N1 virus and urge anyone with symptoms to stay at home, Burnham told the House of Commons.

The first swine flu vaccine would be made available from August, with 60m doses available by the end of the year, he added.

"We have reached the next stage in management of the disease," Burnham said. "The national focus will be on treating the increasing numbers affected by swine flu. We will move to this treatment phase across the UK with immediate effect."

The move does not mean the H1N1 virus, which was declared a pandemic by the World Health Organisation last month, is becoming more deadly, just that it can no longer be contained.

Burnham said there was a "considerable rise" in swine flu cases last week.

"We have always known it would be impossible to contain the virus indefinitely and at some point we would need to move away from containment to treatment.

"Cases are doubling every week and on this trend we could see over 100,000 cases per day by the end of August.

"The pressure on the system is such that it is the right time to take this step. Scientists can expect to see rapid rises in the number of cases."

Burnham added that the public should be reassured by the steps being taken to tackle the virus. He said: "We are the only country in the world to be able to offer anti-virals to everyone as well as those at greater risk."

The government's chief medical officer, Professor Sir Liam Donaldson, said the production of a vaccine was "at an advanced stage" and denied that the outbreak was out of control.

Speaking at a special briefing at the Department of Health, he said: "We are continuing to take a very firm grip on this situation. We have a big stockpile of anti-virals, the biggest probably in the world. We have vaccine at an advance stage of production."

Donaldson added that despite its rapid spread, the virus outbreak was "following a predictable path".

The Health Protection Agency said a further 458 patients in England had been confirmed with swine flu, while the figure for the UK as a whole rose to 7,447.

Efforts to trace people who had been in contact with swine flu cases would now stop and schools no longer needed to close when hit by the virus, unless particular circumstances made it necessary.

The government has said that not everybody with swine flu would receive anti-viral drugs, which may be reserved for at-risk groups.

The daily collation of swine flu cases would also end because it was proving time-consuming. Instead, "more general" estimates of numbers would be given. Other affected countries already update their swine flu numbers less frequently, such as weekly or every other day.

The Scottish health secretary, Nicola Sturgeon, announced a similar shift in swine flu policy at a simultaneous briefing in Edinburgh.

She said: "We've always said it would be impossible to limit the spread of what is a contagious virus indefinitely.

"We've always said that, when it did start to spread more widely within communities, we would require to make a judgment about when to shift efforts from intense containment to treatment, or mitigation."

Sturgeon, who is also the deputy first minister of Scotland, said "high-risk" groups such as children under five, pregnant women and the elderly would get priority access to medication.

Scotland's chief medical officer, Harry Burns, said the country could expect to have a tenth of the UK cases of swine flu. He predicted there would be about 10,000 new cases a day in Scotland by August.

He said: "It could be a bit less, it could be a bit more. It also presupposes that there isn't a downturn, if it continues to rise at this rate, and it's doubling approximately every week, you can do the sums yourself."

However, Scottish health officials said the swine flu infection rate may have already peaked, as the number of new cases in three hotspots in the greater Glasgow area appears to be in decline.

After infection rates peaked at 111 confirmed cases on 25 June, with Scotland experiencing the first two swine flu deaths in Europe, the rate has remained steady at about 60 new cases a day over the last week.

The rapid spread in two of the major hotspots Dunoon in Argyll and Paisley south of Glasgow now appears to have stopped and cases have begun to decline sharply.

The official statistics on the virus were likely to underestimate the true scale of infection in the UK because now only a sample of patients in the hotspots had a diagnosis of swine flu confirmed by lab tests. Many people were thought to have such mild symptoms that they were not bothering to contact their doctors while others were being treated in surgeries without being regarded as suspected swine flu cases.

In swine flu hotspots such as London, the West Midlands and parts of Scotland diagnosis of the virus was already being done by doctors rather than laboratory testing, and tracing the contacts of people with swine flu and the use of preventative anti-viral drugs had stopped. Anti-viral drugs were still being offered to all people with symptoms.

Although a bout of swine flu was currently causing less serious illness than traditional seasonal flu, three people with other serious health conditions in the UK have died after catching the virus and there are concerns it could mutate into a more virulent form.

The chief medical officer, Sir Liam Donaldson, has warned that there may be tens of thousands of cases each week this autumn, because the virus is more likely to thrive in a colder climate.

http://www.guardian.co.uk/world/2009/jul/02/swine-flu-uk

Peter Lemkin
08-03-2009, 06:51 AM
Scary reading....http://www.globalresearch.ca/index.php?context=va&aid=14543

Dawn Meredith
08-03-2009, 01:50 PM
Scary reading....http://www.globalresearch.ca/index.php?context=va&aid=14543

Peter: These articles are all over facebook. Very scary indeed. I have noticed that many are from this same source "global research". What do we know about them?

I have seen studies also that the vaccine is killing many and yes many articles that it will be FORCED on us via the military. Yet many are just "yawn"....I cannot IMAGINE what it will take to wake people up. I guess when relatives ARE dragged off to FEMA camps...of course then it will be far too late. Seems like it already is. Terrifying times.

And that is why I DO watch tv at bedtime...need to calm down via movies and the like. (Helps a lot with insomnia)

Dawn

Magda Hassan
08-03-2009, 02:11 PM
Scary reading....http://www.globalresearch.ca/index.php?context=va&aid=14543

Peter: These articles are all over facebook. Very scary indeed. I have noticed that many are from this same source "global research". What do we know about them?

I have seen studies also that the vaccine is killing many and yes many articles that it will be FORCED on us via the military. Yet many are just "yawn"....I cannot IMAGINE what it will take to wake people up. I guess when relatives ARE dragged off to FEMA camps...of course then it will be far too late. Seems like it already is. Terrifying times.

And that is why I DO watch tv at bedtime...need to calm down via movies and the like. (Helps a lot with insomnia)

Dawn

Global Reseach is a very good site set up by Michel Chossudovsky in Canada. He is a political economist if I recall and has done a lot of work into globalization. Check out his site. There is tons of really informative articles and writers and researchers there http://www.globalresearch.ca/
Definitely a gold mine with some very rich seams.

Peter Presland
08-03-2009, 04:50 PM
Dawn

I will corroborate Magda's post on Global Research. The site is among my top half a dozen or so for solid analysis of geo-political issues and one of very few that I make a financial contribution to. There are so many good authors contributing that its probably unfair - and unbalancing - to single out a couple, but Michael Chussodovsky (Site owner) and Rick Rozoff on NATO and the US Military spring readilly to mind. MC's 'America's War on Terrorism' and 'The Globalization of Poverty & The New World Order' are seminal works on their subjects IMHO. The site has no advertising (other than for its contributors books) which is a BIG bonus.

Jan Klimkowski
08-03-2009, 05:07 PM
Thirded.

Prof Chossudovsky has undertaken much important and ground-breaking research into the destruction of the former Yugoslavia by NATO and proxies.

The quality of work on Global Research is generally very good, although we all need to use our critical faculties on everything we read or view.

The linked article is by Michel Chossudovsky himself, and contains much sourced material. It makes the extreme case for swine flu being a trojan horse to enable the ruling elites to retain power.

In my judgement, the article deserves to be read carefully and critically. It also deserves to be borne in mind as the "swine flu pandemic" develops over the coming weeks and months.

Ed Jewett
08-03-2009, 05:40 PM
Need that fourth for whist?

I've been reading the Global Research web site for a long time now because, for the most part, it covers issues and says things in a way that mainstream media in American won't. It often "covers" articles that are found on non-mainstream web sites, and looks under the rocks where many will not peer.

"[T]he extreme case for swine flu being a trojan horse to enable the ruling elites to retain power" has been and is being made in many places. Given what I know of strategy, I look at the swine flu thing as being simply another "arrow in the quiver" of a range of tools that have been developed by the military/intel under-world, along with other bio-warfare, disinformation, COINTELPRO, cyberwarfare, the injection of economic chaos, Continuity of Government plans, massive surveillance, neuro-biological and psycho-pharmacological weaponry, the old MK-Ultra-type tools, advancing attacks on civil liberties and the Constitution, and some I haven't named or thought of, and some they haven't developed yet or which are still in the pipeline. Based on what can be ascertained in their use of simulations as well as drills and exercises, and the availability of sophisticated tools for them, even they don't know which tactic they will yet use at any given time.

But the swine flu as a trojan horse is a real possibility because they can do it, they have done it, and all the precursor set-ups (legislation, media conditioning, false flag covers, computer tools, simulations and drills, legal justifications) are in development, are underway, or are in place.

Now if three out of every four Americans are backing the "audit the Fed" legislation drafted by one of the most recognizable Libertarians in the country (whose followers have been "labeled" by some underlings in the government at the "fusion centers" as domestic terrorists, they might not need any swine flu hanky-panky to cement their control. Meanwhile, though, some of the ruling elite make a huge buck off the fact that they have applied a Hegelian dialectic and forced the "state" to buy and deliver the injectables we paid for. Even if the vaccine is perfectly safe and does not carry any side-effect producing baddies (or worse), they've already sent the trojan horse through the gate. (And we keep moving the big gated doors and marveling at the gift of that nice bug horse ...)

Magda Hassan
08-06-2009, 01:57 AM
US Patent 6117667 - Method for producing an adapted virus population from an African green monkey kidney cell line


Inventors



Potash, Louis (http://www.patentstorm.us/inventors-patents/Louis_Potash/994857/1.html)
Chanock, Robert M. (http://www.patentstorm.us/inventors-patents/Robert_M__Chanock/994858/1.html)
Purcell, Robert H. (http://www.patentstorm.us/inventors-patents/Robert_H__Purcell/994859/1.html)
Kapikian, Albert Z. (http://www.patentstorm.us/inventors-patents/Albert_Z__Kapikian/994860/1.html)

Assignee



Dyncorp (http://www.patentstorm.us/assignee-patents/Dyncorp/80150/1.html)
National Institutes of Health (http://www.patentstorm.us/assignee-patents/National_Institutes_of_Health/64516/1.html)

Application

No. 336740 filed on 06/21/1999 US Classes:

435/235.1 (http://www.patentstorm.us/class-patents/435/235.1/VIRUS_OR_BACTERIOPHAGE__EXCEPT_FOR_VIRAL_VECTOR_OR _BACTERIOPHAGE_VECTOR_COMPOSITION_THEREOF_PREPARAT ION_OR_PURIFICATION_THEREOF_PRODUCTION_OF_VIRAL_SU BUNITS_MEDIA_FOR_PROPAGATING/1.html), VIRUS OR BACTERIOPHAGE, EXCEPT FOR VIRAL VECTOR OR BACTERIOPHAGE VECTOR; COMPOSITION THEREOF; PREPARATION OR PURIFICATION THEREOF; PRODUCTION OF VIRAL SUBUNITS; MEDIA FOR PROPAGATING435/239 (http://www.patentstorm.us/class-patents/435/239/Recovery_or_purification/1.html)Recovery or purificationField of Search

435/235.1 (http://www.patentstorm.us/class/435/235.1/VIRUS_OR_BACTERIOPHAGE__EXCEPT_FOR_VIRAL_VECTOR_OR _BACTERIOPHAGE_VECTOR_COMPOSITION_THEREOF_PREPARAT ION_OR_PURIFICATION_THEREOF_PRODUCTION_OF_VIRAL_SU BUNITS_MEDIA_FOR_PROPAGATING/1.html), VIRUS OR BACTERIOPHAGE, EXCEPT FOR VIRAL VECTOR OR BACTERIOPHAGE VECTOR; COMPOSITION THEREOF; PREPARATION OR PURIFICATION THEREOF; PRODUCTION OF VIRAL SUBUNITS; MEDIA FOR PROPAGATING435/239 (http://www.patentstorm.us/class/435/239/Recovery_or_purification/1.html)Recovery or purificationExaminers

Primary: McKelvey, Terry (http://www.patentstorm.us/examiners/Terry_McKelvey/2177234.html)
Attorney, Agent or Firm



Burns, Doane, Swecker & Mathis, LLP (http://www.patentstorm.us/attorney-patents/Burns__Doane__Swecker___Mathis__LLP/698/1.html)

US Patent References

4783407 (http://www.patentstorm.us/patents/4783407.html)Growth of hepatitus A virus in vero cells
Issued on: 11/08/1988
Inventor: Provost , et al.International Classes

C12N 007/00
C12N 007/02
US Patent Issued on September 12, 2000 (http://www.patentstorm.us/patents-by-date/2000/0912/1.html)
Estimated Patent Expiration Date: http://www.patentstorm.us/images/icon_subject.gif (http://www.patentstorm.us/patents/6117667/description.html#) June 21, 2019Estimated Expiration Date is calculated based on simple USPTO term provisions. It does not account for terminal disclaimers, term adjustments, failure to pay maintenance fees, or other factors which might affect the term of a patent.
Abstract (http://www.patentstorm.us/patents/6117667.html) Claims (http://www.patentstorm.us/patents/6117667/claims.html) Description Full Text (http://www.patentstorm.us/patents/6117667/fulltext.html)
loading...
http://www.patentstorm.us/images/patents/6117667.png


View Patent Images (PDF) (http://www.patentstorm.us/patents/pdfs/patent_id/6117667.html)

(Registered users only)

Description



FIELD OF INVENTION

The invention relates to a novel African Green Monkey Kidney (AGMK) cell subtrate that supports the efficient replication of human and animal rotaviruses, astroviruses, enteroviruses including the Sabin live attenuated poliovirus vaccine strains, hepatitis A virus and respiratory viruses such as respiratory syncytial virus, parainfluenza viruses, and influenza A and B viruses.

The invention is also useful for the production of virus suspensions suitable for use in vaccines for immunization of humans.

BACKGROUND OF INVENTION

Rotaviruses are major causal agents of acute gastroenteritis in man with a world-wide distribution. Enteroviruses have been implicated in infections of the gastrointestinal tract, the respiratory system and in aseptic meningitis. Respiratory syncytial virus (RSV), the parainfluenza viruses and the influenza viruses have been shown to be the major causal agents of serious pediatric diseases such as croup, bronchiolitis and pneumonia, while the influenza viruses are the major cause of serious febrile respiratory tract illness in adults. Hepatitis A virus is the cause of hepatitis A, one of the major infectious diseases of the liver.

Rotavirus infections occur world-wide and are responsible for a large proportion of severe, life-threatening, often fatal diarrheal disease. Most rotavirus disease is caused by the four major human rotavirus serotypes but other serotypes are being discovered continuously. The latter are usually restricted in geographic distribution, but they could become a larger problem at any time. World-wide, the human rotaviruses are the major etiologic agents of serious acute gastroenteritis in infants and young children and on occasion can cause debilitating diarrhea in adults. It has been estimated by the World Health Organization that rotaviruses are responsible for one million fatal diarrheal illnesses each year in infants and young children in developing countries.

The most important cause of serious viral respiratory illness in children is respiratory syncytial virus (RSV). The parainfluenza viruses, influenza viruses, and adenoviruses are also important in this regard. Especially in the case of respiratory syncytial virus (RSV), of which there are two major subgroups A and B, immunity does not appear to be long-lasting and re-infections can and do occur with high frequency during infancy, through the pre-school period, and throughout adult life. The parainfluenza viruses, of which there are four major types--1, 2, 3 and 4--have been implicated as important causes of croup, bronchiolitis and pneumonia in infants and young children. These viruses are second only to RSV as a cause of severe viral respiratory tract disease. In adults, the influenza viruses are a major cause of mortality in older persons with underlying acute or chronic cardiac or pulmonary disease. The serious systemic disease manifestations of influenza virus infections are well known and the frequent antigenic shifts in serotype [A/H1N1, A/H3N2 and B] necessitate changes in the composition of the strains included in the yearly vaccine preparations.

The enteroviruses, which are a subgroup of picornaviruses consisting of polioviruses, Coxsackie viruses and echoviruses, have been shown to cause a broad spectrum of illnesses. These illnesses include paralytic disease, encephalitis, aseptic meningitis, pleurodynia, exanthems, and pericarditis with some of the infections resulting in debilitating sequelae. Hepatitis A virus, also a picornavirus, is a major cause of sporadic as well as epidemic hepatitis.

According to convention, semi-continuous cell systems which are diploid and have a finite longevity in terms of the number of passages that can be achieved in the laboratory are designated as cell strains, whereas continuous cell systems that are aneuploid and can be passaged indefinitely in the laboratory (i.e., are immortal) are designated as cell lines. A limiting factor in the development of vaccines for combating the maladies caused by a number of these infectious agents has been the lack of availability of an acceptable cell strain or line capable of supporting the growth of these viruses to a concentration suitable for use in vaccine production. Convenient and susceptible cell strains and/or lines that can be cultured using relatively high split ratios (i.e., the preparation of multiple tissue culture vessels from a single culture) and which can be approved for human use by the Center for Biologics Evaluation and Research (CBER) of the Food and Drug Administration (FDA) are needed to enable and facilitate vaccine development for certain medically important viruses that are uncontrolled currently.


Semi-continuous or continuous cell culture systems capable of supporting the growth of hybrid rotaviruses, hereafter designated human x animal rotavirus reassortants, have included the simian cell strain, FRhL-2, and the simian cell lines, CV-1 and Vero. Live virus vaccines produced in these cells have received CBER, FDA approval for Phase I and II studies. Henceforth, we will refer to these cell strains or lines as certified cell strains or lines to distinguish them from cell strains or lines that have been licensed for production of human vaccines. To date, only two semi-continuous cell culture systems, WI-38 and MRC-5, both human fetal diploid cell strains, have been licensed for use in virus vaccines. These cell strains will be referred to as licensed cell strains. Currently, there are no licensed continuous cell lines.

The above mentioned certified cell strain or lines (FRhL-2, CV-1 and Vero) are limited in their ability to support the growth of completely homologous human rotaviruses, i.e., rotaviruses that derive each of their 11 RNA gene segments from a human rotavirus. In addition, the FRhL-2 cell strain, with a maximum 1:3 split ratio capability, is limited in its ability to support the growth of important RSV. The CV-1 cells, with a maximum 1:4 split ratio capability, have not supported the growth of many viral agents to a level satisfactory for vaccine production. The Vero cells, with a split ratio of 1:6-1:10, are limited in their ability to support the growth of a number of enteroviruses and fail to support the efficient growth of completely homologous human rotaviruses.

Naturally occurring strains of hepatitis A virus (HAV), a picornavirus distantly related to the enteroviruses, do not grow well in any cell type during primary isolation and must be adapted to growth in cells of primate origin before the level of virus replication required for vaccine development and production can be achieved. Inactivated whole-virus HAV vaccines grown in fetal human fibroblast MRC-5 cells have been developed, but the low split ratio of 1:2 required by these cells, the low viral titers achieved, and the prolonged cultivation time of up to two weeks necessary for maximum yield of viral antigen make such vaccines expensive. Growth of HAV in simian CV-1, FRhK4 (a fetal rhesus monkey kidney cell line), FRhK-6 (another fetal rhesus monkey kidney cell line) and Vero cells has been variable depending on the strain and passage level of virus, but generally is suboptimal. Best growth has been obtained in a cloned cell line, designated clone 11-1, derived from FRhK4 cells, but these cells contain bovine papilloma virus sequences and thus, are not suitable for vaccine development.

Candidate live attenuated and inactivated HAV vaccines have been developed by adaptation of the virus to growth in primary African green monkey (AGMK) cells but such vaccines are not economically feasible because of the extreme difficulty of obtaining sufficient primary AGMK cells that are free of extraneous viral agents of monkey origin. Live attenuated and inactivated HAV vaccine candidates have been adapted to growth in MRC-5 cells, a human fetal diploid cell strain, but such adaptation has consistently led, respectively, to over-attenuation of the live attenuated virus for humans and a relatively sparse yield of inactivated virus vaccine.

Thus, there remains a need for a cell strain or line capable of supporting the efficient growth of a large number of human viral pathogens such as the human rotaviruses, enteroviruses, HAV, and respiratory viruses of major medical importance including RSV, influenza viruses and parainfluenza viruses. Such a cell strain or line would facilitate the development and production of commercially useful and effective vaccines. There is a pressing need for the development of vaccines against these viruses in order to prevent severe viral diseases of infants, children, adults and the elderly.

Therefore, the availability of a single cell strain or line capable of supporting the efficient replication of those viral agents responsible for a significant number of childhood and adult diseases would provide a significant advancement in the formulation and production of multivalent vaccines.

SUMMARY OF THE INVENTION

The present invention is directed to a cell substrate that substantially overcomes the limitations of previously established cell strains or lines. The serially passaged cells of the present invention are derived from the paired kidneys of an African green monkey and support the efficient growth of medically important human rotaviruses, astroviruses, picornaviruses such as enteroviruses including the Sabin live attenuated poliovirus vaccine strains and hepatitis A virus, and respiratory viruses such as respiratory syncytial virus, parainfluenza viruses, and influenza A and B viruses.

The AGMK cells of the invention are designated as a cell substrate because it is not clear at this time whether they constitute a cell strain or cell line. It is probable that they are a cell line because they are aneuploid, an essential and defining property of cell lines. However, the AGMK cells have been passaged serially only 30 times and assignment of cell immortality, one of the other defining features of a cell line, requires more than 50 serial passages.

At the 30th passage there was no diminution of viability, or ability to grow nor was there any other outward sign of senescence. Furthermore, the AGMK cells have been split 1:4 or 1:8 at each of these passages, a split ratio that is characteristic of cell lines but not cell strains which usually can not be split more than 1:2.

An important advantage of the present invention is that the cell substrate, based on currently promulgated guidelines (i.e., "Points to Consider in the Characterization of Cell Lines Used to Produce Biologicals" (May 1993)) and state-of-the-art testing, has been demonstrated to be free of detectable adventitious microbial agents. This feature allows the cell substrate to be employed for the growth of viruses, such as the human rotaviruses and hepatitis A virus, which have a very highly restricted and narrow tissue culture host range. The unavailability of such a clean cell system prior to this invention has hampered vaccine development for these viruses. In addition, the cell substrate can be used in studies which require cultures of monkey kidney cells free of simian adventitious agents. The commercially available monkey kidney cell cultures are frequently contaminated with these agents, which negate or becloud any results obtained and preclude their use in vaccines destined for administration to humans. This invention also offers the advantage of a cell substrate which can be trypsinized and split in ratios ranging from 1:4 to 1:8 depending upon vessel size and time constraints imposed by vaccine production deadlines.

Additional features and advantages of the invention will be set forth in the description which follows or may be learned by practice of the invention. The objectives and other advantages of the invention to be realized and attained will be cited in the written description and claims hereof as well as the appended drawings.

To achieve these and other advantages and in accordance with the purpose of the invention, as embodied and broadly described, the invention provides a cell line derived from the paired kidneys of an African green monkey, which is free of demonstrable adventitious microbial agents. The invention also provides a method for establishing the cell line by the enzymatic disaggregation of the paired kidneys from an African green monkey and continuous cultivation of the resulting cells. In addition, the invention provides a method for recovering and serially propagating specific viruses in the cell line that subsequently can be used for production of a viral vaccine.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 outlines the passage history from a single ampoule of a disassociated African Green Monkey Kidney sample to the preparation of a Master Seed Cell Bank (MSCB) and a Master Working Cell Bank (MWCB).

FIG. 2 outlines the passage history from single ampoule from the MWCB to post-production history.

FIG. 3 depicts the results of a radioimmunofocus assay of HAV/7 as a fraction of time for plaque formation for 11-1 cell (FRhK-derived cell line) and for AGMK cells.

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides a cell line derived from a pair of African green monkey kidneys. The cell line is free of demonstrable viable adventitious microbial agents. In addition, the cell line is capable of supporting the growth of viruses such as human rotaviruses, astroviruses, enteroviruses, respiratory viruses and hepatitis A and is, therefore, useful for propagating viruses necessary for the production and formulation of a number of effective vaccines on a scale that makes such vaccines commercially feasible.

Specifically, the present invention relates to an aneuploid cell substrate with chromosome counts in the diploid range which was initiated by the enzymatic disaggregation of paired kidneys from a female Cercopithecus African green monkey. A deposit of the cell line at passage No. 13, Lot 6500 has been made with the American Type Culture Collection, 10801 University Boulevard, Manassas, Va. 20110-2209, USA, on Nov. 4th, 1994 and has been assigned accession No. ATCC# CRL 11756.

This cell line was deposited according to the Budapest Treaty. If the deposited culture should die or otherwise become lost or destroyed, this cell line will be replaced with a living culture containing this cell line. This cell line will be maintained for a period of at least 30 years after the date of deposit, and for a period of at least 5 years after the most recent request for a sample. This cell line will be made available if a Patent Office signatory to the Budapest Treaty certifies one's right to receive, or if a U.S. Patent is issued to this application or any other applications claiming benefit of priority to this application.

The present invention also provides a method of establishing a cell substrate capable of at least 30 serial passages that is initially derived by the enzymatic disaggregatior of kidneys from an African green monkey. In addition, the invention provides a method for recovery and growth of specific viruses, a necessary first step for subsequent vaccine production.

It will be apparent to those skilled in the art that various modifications and variations can be made in the cell substrate of the present invention and in its uses without departing from the spirit or scope of the invention. Thus, it is intended that the present invention covers the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents.

Having now described the invention in general terms, it will be better understood by reference to certain examples which are included herein for the purpose of illustration only and are not intended to be limiting unless otherwise specified.

EXAMPLE 1

Derivation of the AGMK Cell Substrate

Source: The cell substrate was derived from the kidneys of an African green monkey from a colony that had been established on Barbados. The cells are free of any demonstrable viable adventitious microbial agents. The microbial agents include, but are not limited to bacteria, fungi, mycobacteria, mycoplasma and simian agents such as retroviruses, foamy viruses, hemadsorbing viruses, herpes-like viruses and multi-nucleating or syncytial viruses. The kidneys were processed using conventional enzymatic disaggregation technology. The resulting kidney cell suspension was used to initiate 3 primary flask [T150 cm2 ] cultures with the remainder, designated as Freeze #2129, distributed into multiple ampules and frozen for storage in a liquid nitrogen freezer. The primary flask cultures labelled A, B and C, were processed as follows:

Flask A: On day 14 split 1:2=1-A-1 & 1-A-2 with one of these flasks split on day 28 1:2=2-A-1 & 2-A-2

Flask B: On day 21 split 1:2=1-B-1 & 1-B-2 with one of these flasks split on day 35 1:2=2-B-1 & 2-B-2

Flask C: Not split

The maintenance medium consisted of Eagle's Minimal Essential Medium (EMEM) +5% fetal bovine serum (heat inactivated at 56 C. for 30 min.) +1% glutamine (200 mM). All flask cultures were refed with 100 ml of fresh maintenance medium on a weekly basis for a total incubation period of 9 weeks based on the initial planting date. The cultures were negative for hemadsorption and CPE (cytopathic effect), the latter determined by microscopic examination after fixation and staining.

The passage history from a single ampule to the preparation of the Master Seed Cell Bank (MSCB) and the Master Working Cell Bank (MWCB) is depicted in FIG. 1. Cultures were handled in a Class 100 Laminar Flow Hood and in an area where only normal tissue cultures and/or vaccine-designated cell systems were cultured. Cultures were serially passaged employing a 1:4 to 1:6 split ratio with incubation at 36 C.1 C. and utilizing the following methodology:

1. Cell films were washed with Hanks' Balanced Salt Solution (HBSS) without Ca++ and Mg++.

2. Films were disaggregated by the addition of a trypsin-EDTA solution and incubation at 36 C.+1 C. for 4-5 minutes.

3. Films were broken up by rapid pipetting with the cells suspended in the growth medium [EMEM+10% fetal bovine serum+1% glutamine] and seeded into appropriate size culture vessels.

The passage history from single ampules from the MWCB to the post-production testing is outlined in FIG. 2.

EXAMPLE 2

Testing of the Master Working Cell Bank--Passage 7A, Lot #4214

1. KARYOTYPING AND SPECIES IDENTIFICATION

Passage 7A, Lot #4214 was characterized by Giemsa banded chromosome analysis and reaction with species-specific antisera and isoenzyme analysis.

a. Cytogenic Characterization

Conventional chromosome staining (non-banded) was utilized to determine chromosome count ploidy distribution per 100 metaphases. Identifiable markers and aberrations were analyzed for 50 metaphases.

Chromosome banding by trypsin-Giemsa was utilized to analyze the karyotype and identify specific chromosome markers. Species confirmation was made using G-banding patterns and chromosome morphology. The procedures used were modifications of those described by Peterson, W. D., Jr., Simpson, W. F., and Hukku, B., Cell culture characteristics: Monitoring for cell identification, in Jakoby, W. B. and Pastan, I. H., eds., Methods in Enzymology 58:164-178, 1979; and Seabright, M., A rapid banding technique for human chromosomes, Lancet, ii:971-972, 1971.

The cell line was identified as an aneuploid female Cercopithecus (African green) monkey (XX) with chromosome counts in the diploid range. Most of the chromosomes were normal and present in two copies each. Normal chromosome D was monosomic and a single marker D chromosome was observed.

b. Species Identification of Cell Culture

The ability of the test cell preparation to react with species-specific antisera was determined using the fluorescent antibody technique as described by Peterson et al., supra. The cells reacted with monkey antiserum but not with mouse or hamster antiserum.

c. Isoenzyme Analysis

Enzyme preparations were made from the test article cells. The electrophoretic migration distances of the enzymes were compared with known migration distances of enzymes in various mammalian species as described by Halton, D. M., Peterson, W. D., Jr., and Hukku, B. Cell culture quality control by rapid isoenzymatic characterization, In Vitro 19:16-24, 1983; Ottenbreit, M. J., Halton, D. M., and Peterson, W. D., Jr., Rapid isoenzyme analysis of cell cultures by agarose electrophoresis, I. Interspecies identification, J. Tissue Culture Methods, 6:107-110, 1982; and II. Intraspecies identification of human cell lines, J. Tissue Culture Methods, 8:125-130, 1986.

The electrophoretic mobilities of enzymes glucose-6-phosphate dehydrogenase (G6PD), nucleoside phosphorylase NP), malate dehydrogenase (MDH) and lactate dehydrogenase (LDH) present in an extract prepared from the test cells were comparable to those of a Cercopithecus (African green) monkey control cell preparation. No extra bands were observed on the electrophoresis films that might suggest the presence of cells of a species other than that of the cell culture.

Cells other than those of the submitted culture (MWCB, Passage 7A, Lot# 4214) were not detected in the culture by either isoenzyme analysis or by cytogenic evaluation.

2. DETECTION OF RETROVIRUSES

a. Detection of Retrovirus Particles by Electron Microscopic Examination

A cell pellet of the test article cells (MWCB, Passage 7A, Lot# 4214) was prepared and examined for the presence of virus particles by transmission electron microscopy. No retrovirus-like particles were found in the 200 cells observed.

b. Detection of Retrovirus Reverse Transcriptase in the Presence of DNA-Dependent DNA Polymerase

The test article (MWCB, Passage 7A, Lot# 4214) was analyzed for the presence of types B, C and D retrovirus reverse transcriptase and cellular DNA polymerase activity. No evidence for the presence of retrovirus reverse transcriptase was observed.

The results are presented in Table I-A, B and C.

TABLE I-A ______________________________________ Reverse Transcriptase and DNA Polymerase Activities in Test Article AGMK MWCB Cell Cultures: p7A, L-4214 Adjusted Reverse Transcrip- Reverse DNA tasea Transcriptaseb Polymeraseb (rAdT) (rAdT) (dAdT) Sample Mn++ Mn++ Mn++ Mn++ Mn++ ______________________________________ Test Article Undiluted 22 25 0 7 0 Diluted 2-fold 6 8 0 19 1 in mediumc Diluted 2-fold 20,837 433 10 0 in R-MuLVd Diluted 2-fold in 795 6 7,137 508 DNA polymerasee Positive and Neg- ative Controlsf R-MuLV diluted 18,589 549 12 0 2-fold in mediumg DNA Polymerase 1,079 25 5,443 542 diluted 2-fold in mediumg SMRVh 2,585 48,289 211 396 Stabilization (63) (59) (67) .sup. (58) Bufferi Mediumc (65) (57) (65) .sup. (52) Mediumg (78) (56) (62) .sup. (49) ______________________________________ a Reverse transcriptase activity adjusted for the effect of DNA polymerase (Table 2 and Methods). b Expressed as counts per minute 3 Hthymidine triphosphate incorporated (mean duplicates minus background). c EMEM + 10% serum subtracted from test article samples. d RMuLV (Rauscher Murine Leukemia Virus) Type C virus positive control. e DNA polymerase Positive control; prepared from mink lung cells. f Control monitoring background of incorporation of 3Hthymidine triphosphate (reaction mixture with undiluted test article minus template primers) = 61 cpm (medium background not subtracted). g EMEM + 10% serum subtracted from RMeLV and DNA polymerase positive controls. h SMRV (Squirrel Monkey Retrovirus Preparation) Type D virus positive control. i Stabilization buffer used to dilute SMRV positive control.

TABLE I-B ______________________________________ Adjustment of Reverse Transcriptase Values for Interference by Polymerase in Test Article AGMK MWCB Cell Cultures: p7A, L-4214 DNA Polymerase Assay (CPM) RT Assay (CPM) DNA Observeda Adjustedb Observed Polymerase Test Article (Mn++) (Mn++) (Mn++) Slope ______________________________________ Undiluted 25 22 37 3 Diluted 2-fold 8 6 19 2 in mediumc ______________________________________ a Unadjusted 3 HTTP incorporation catalyzed by RT. May include effects by cellular DNA polymerase. b Adjusted 3 HTTP incorporation catalyzed by RT = Observed RT (DNA polymerase Slope). Slope = 0.08. c Medium used to dilute test article.

TABLE I-C ______________________________________ Reverse Transcriptase and DNA Polymerase Activities in a DNA Polymerase Preparation from Reverse Transcriptase-Negative Cell Cultures (Used for Determinig Interference in Reverse Transcriptase Assay by DNA Polymerase) Reverse Transcriptaseb DNA Polymeraseb (rAdT) (dAdT) DNA Polymerasea Mn++ Mg++ Mn++ Mg++ ______________________________________ Sample 1 116 10 1,898 198 Sample 2 187 0 2,634 0 Sample 3 547 6 6,690 119 Sample 4 574 3 8,529 81 Sample 5 1,196 27 14,315 1,222 ______________________________________ a DNA polymerase prepared from mink lung cells. b Expressed as counts per minute 3 Hthymidine triphosphate incorporated [mean duplicates minus background (medium)].

EXAMPLE 3

Post-Production Cell Testing

1. Karyotyping and Species Identification

The AGMK cells at Passage 17A, Lot #4706 were characterized by Giemsa banded chromosome analysis and reaction with species-specific antisera and isoenzyme analysis.

The cells were identified as aneuploid female Cercopithecus (African green) monkey (XX, XXX) with chromosome counts in the hypodiploid to hyperdiploid range. All karyotypes examined contained a single normal Cercopithecus monkey marker chromosome (Group D) and a second partially deleted Cercopithecus monkey D group marker chromosome.

The electrophoretic mobilities of the enzymes G6PD, NP, MDH and LDH present in an extract prepared from the test cells were comparable to those of Cercopithecus (African green) monkey control cell preparation. No extra bands were observed on the electrophoresis films that might suggest the presence of cells of a different species in the cell culture. The cells reacted with monkey antiserum but not with mouse antiserum.

Cells other than those of the submitted culture (Passage 17A, Lot #4706) were not detected in the culture by either antisera reaction, isoenzyme analysis or by cytogenic evaluation. The chromosome pattern was similar to that previously observed for cells in the MWCB, Passage 7A, Lot #4214 and specifically related these cells (Passage 17A, Lot #4706) to the former.

2. Detection of Retroviruses

a. The Test Article, AGMK Passage 17A, Lot #4706

Was analyzed for the presence of types B, C and D retrovirus reverse transcriptase and cellular DNA polymerase activity. The cells were grown in the presence of 30 ?g/ml bromodeoxyuridine for 24 hours (day 0 to day 1) and then refed with medium without inducer. Culture fluids (unconcentrated and concentrated 20-fold) were harvested on days 2, 3 and 4. No evidence for the presence of retrovirus reverse transcriptase activity was observed in the test article. The results are presented in Table II-A, B and C.

b. Detection of Retrovirus Particles by Electron Microscopic Examination

Cell pellets were prepared from the treated and untreated cultures harvested on day 4 and examined for the presence of virus particles by transmission electron microscopy. No retrovirus-like particles were found in the 200 cells observed.

c. Detection of Simian T-Lymphotropic Virus (STLV) in Test Article (AGMK, Passage 17A, Lot #4743) by Polymerase Chain Reaction (PCR) Technique

The polymerase chain reaction (PCR) provides a method for detection of extremely low numbers of viral nucleic acid sequences, which would not be detectable without amplification. When coupled with a pre-PCR reverse transcriptase step, RNA sequences may be amplified, thus allowing detection of free virus. The protocol used allowed for the amplification of either DNA or RNA derived STLV-specific sequences. The PCR products were tested by Southern blotting, using chemiluminescent enzyme-linked probe hybridization to the blot.

When tested with the STLV pol primers SK110/SK111, STLV-specific product was not detected in test article reactions, each of which represented 1.0 ?g nucleic acid extracted from the test article. In the positive control series, which contained the equivalent of 0.001 ?g, 0.01 ?g, 0.1 ?g or 1 ?g of nucleic acid extracted from a cell line infected by STLV (STLVmn103), STLV-specific product was detected in all reactions. On the basis of failure to detect reactivity with STLV primers, the test article was judged to be negative for STLV nucleic acid sequences.

d. Detection of the Simian Immunodeficiency Virus in Test Article (AGMK, Passage 18A, Lot #5506)

Total cellular DNA was extracted from the test article and subsequently tested for the presence of SIVagm virus sequences using primers that amplify a 200 bp fragment of the LTR. This involved PCR with nested sets of primers as follows:

Outer set #1807 F: CCTCAGAGCTGCATAAAAGCAGAT (SEQ ID NO:1) - #1808 R: TCACTCAAGTCCCTGTTCGGGCGC (SEQ ID NO:2) - Inner set #1809 F: TACTAGGAGACCAGCTTGAGCCTG (SEQ ID NO:3) - #1810 R: TGCTGGAGTTTCTCTCGCCTGGGT (SEQ ID NO:4)

These primers were designed for the conserved U5 and R regions of the LTR and are capable of amplifying all subtypes of SIVagm. The predicted 200 bp fragment was amplified from DNA extracted from a chronically-SIVagm infected cell line (SIVagm 155CEMss) but the African green monkey cells did not have detectable SIVagm sequences by Southern blot analysis.

3. Tumorigenicity in Athymic Nude Mice

The cells were found to be non-tumorigenic after being clinically evaluated for 150 days. Athymic nude mice were inoculated subcutaneously with approximately 1107 test article cells (AGMK Passage 17A, Lot #4889). Athymic nude mice were similarly inoculated with positive control cells. All 10 positive control inoculated mice had tumors at the site of inoculation. No metastases were observed in the inoculation site (skin), lung, lymph nodes, liver, kidney, spleen or brain of mice inoculated with the test article.

TABLE II-A ______________________________________ Reverse Transcriptase and DNA Polymerase Activities in Unconcentrated AGMK Passage 17A, Lot #4706 Reverse Trans- DNA Poly- criptasea merasea Sample (rAdT) (dAdT) Test Article Cellsb Mn++ Mg++ Mn++ Mg++ ______________________________________ DAY 2 Untreated 0 0 227 0 Treated 29 0 485 85 3 Untreated 0 0 265 6 Treated 0 0 243 0 4 Untreated 35 0 711 29 Treated 48 0 723 26 ______________________________________ a Expressed as counts per minute 3 Hthymidine triphosphate incorporated (mean duplicates minus background). b Culture fluids from test article cells.

TABLE II-B ______________________________________ Reverse Transcriptase and DNA Polymerase Activities in AGMK Passage 17A, Lot #4706 Concentrated 20-fold Reverse Trans- DNA Poly- criptasea merasea Sample (rAdT) (dAdT) Test Article Cellsb Mn++ Mg++ Mn++ Mg++ ______________________________________ DAY 2 Untreated 9 0 18 87 Treated 0 0 15 104 3 Untreated 6 0 32 125 Treated 9 3 19 136 4 Untreated 22 3 14 114 Treated 122 2 2,423 516 ______________________________________ a Expressed as counts per minute 3 Hthymidine triphosphate incorporated (mean duplicates minus background). b Culture fluids from test article cells.

TABLE II-C ______________________________________ Reverse Transcriptase and DNA Polymerase Activities in AGMK Passage 17A, Lot #4706 Sample Reverse Transcriptasea DNA Polymerasea Positive and Negative (rAdT) (dAdT) Controls Mn++ Mg++ Mn++ Mg++ ______________________________________ R-MuLVc 65,913 2,230 0 16 SMRVd 12,031 133,798 1,274 2,825 DNA Polymerasee 7,015 57 60,197 6,646 Mediumf (163) (74) (242) (107) Stabilization Bufferg (53) (59) (46) (44) Mediumh (146) (136) (321) (148) ______________________________________ a Expressed as counts per minute 3 Hthymidine triphosphate incorporated (mean duplicates minus background). b Culture fluids from test article cells. c RMuLV (Rauscher murine leukemia virus) Type C virus positive control. d SMRV (Squirrel Monkey Retrovirus Preparation) Type D virus positive control. e DNA polymerase Positive control; prepared from mink lung cells. f Medium Subtracted from unconcentrated, untreated and treated samples. g Stabilization buffer Negative control; subtracted from positive controls and concentrated samples. h Medium Subtracted from RMulV and DNA polymerase positive controls

EXAMPLE 4

Post-Production Testing for Microbial Sterility

1. Bacterial Sterility in Fluid Thioglycollate Medium

Each of 10 culture tubes (9-10 ml medium per tube) was inoculated with 1.0 ml of the AGMK cell suspension (Passage 17A, Lot #4706) containing approx. 5105 cells per ml. Each of 5 tubes was inoculated with 1.0 ml of the original growth medium. Ten cultures were included as uninoculated controls. All cultures were vortex mixed and incubated at 32 C.2 C. for 21 days with observations made on days 1, 3, 6, 8, 10, 13, 15, 17, 20 and 21. No growth was observed in any of the 25 cultures.

2. Fungal Sterility in Soybean Casein Digest Medium

Each of 10 culture tubes (9-10 ml medium per tube) was inoculated with 1.0 ml of the AGMK cell suspension (Passage 17A, Lot #4706) containing approx. 5105 cells per ml. Each of 5 tubes was inoculated with 1.0 ml of the original growth medium. Ten cultures were included as uninoculated controls. All cultures were vortex mixed and incubated at 22 C.2 C. for 21 days with observations made on days 1, 3, 6, 8, 10, 13, 15, 17, 20 and 21. No growth was observed in any of the 25 cultures.

3. Mycobacterial Sterility in Lowenstein-Jensen Egg Medium

Each of 10 slant culture tubes was inoculated with 0.5 ml of the AGMK cell suspension (Passage 17A, Lot #4706) containing approx. 5105 cells per ml. Each of 10 culture slants was inoculated with 0.5 ml of the original growth medium. Six cultures were included as uninoculated controls. All cultures were incubated at 36 C.1 C. horizontally for the first 24 hours and vertically for the remainder of the 8 week observation period with weekly observations for growth. On day 28, one cell suspension inoculated culture was found contaminated with a mold. No growth was observed in any of the remaining 25 cultures after 8 weeks.

This assay was repeated with AGMK Passage 18A, Lot #4918, but using 6 culture slants inoculated with the original growth medium. No growth was observed in any of the 22 cultures after 8 weeks. The results of the above Microbial Sterility Assays are summarized in Table III.

4. Mycoplasma Sterility

The assay for mycoplasma was performed using both the direct Broth Enrichment and Agar Procedures and the indirect Indicator Cell Culture Procedure with the AGMK cell suspension (Passage 17A, Lot #4706) containing approximately 5105 cells per ml. The cell suspension was found to be negative for mycoplasmas by all procedures.

TABLE III __________________________________________________ ________________________ Microbial Sterility Test Results on the AGMK Cell Suspension - Passage 17A, Lot #4706 and #4918 at Approximately 5 105 Cells/ml Vol. Per. Culture Date Culture Medium No. (ml) Temp. On Test Off Test Results __________________________________________________ ________________________ Fluid Thioglycollate (FIM) LOT VVPL #122-50 10 -- 32 C. 1/05/93 1/26/93 No Growth Cell Suspension #4706 10 1.0 (2.degr ee. C.) | | No Growth Culture Medium 5 1.0 1/05/93 1/26/93 No Growth Soybean-Casein-Digest (SCDM) LOT VVPL #112-51 10 -- 22 C. 1/05/93 1/26/93 No Growth Cell Suspension #4706 10 1.0 (2.degr ee. C.) | | No Growth Culture Medium 5 1.0 1/05/93 1/26/93 No Growth Lowenstein-Jensen Egg Medium - LOT #C3CPPB 6 -- 36 C. 1/05/93 3/02/93 No Growth Cell Suspension #4706 10 0.5 (1.degr ee. C.) | | 1/10 mold | | on day 28 Culture Medium 10 0.5 1/05/93 3/02/93 No Growth Lowenstein-Jensen Egg Medium - LOT #H3CTGX 6 -- 36 C. 2/23/93 4/20/93 No Growth Cell Suspension #4918 10 0.5 (1.degr ee. C.) | | No Growth Culture Medium 6 0.5 2/23/93 4/20/93 No Growth __________________________________________________ ________________________

EXAMPLE 5

In Vitro Tissue Culture Purity and Safety Tests for the Detection of Viable Adventitious Microbial Agents

These assays were performed in roller tube cultures of the following tissue culture systems: Serially passaged African green monkey kidney (AGMK); Primary Human Amnion (PHA); Vero; Primary Rabbit Kidney (PRK); Whole Human Embryo Fibroblast (Fl 5000); and Human Carcinoma of the Larynx (H.Ep-2). Cultures were maintained on Medium EMEM containing 2-10% fetal bovine serum (gamma irradiated) plus antibiotics: gentamicin, 100 ?g/ml; neomycin, 50 ?g/ml; and fungizone, 2.5 ?g/ml. Cultures were refed with 2 ml of maintenance medium prior to inoculation.

Testing Procedures

The cell suspensions (Lots #4742/3, #4755 or #4889 containing approximately 5105 cells per ml) were inoculated in 0.5 ml amount per each of 28 roller tubes per tissue culture system. Cultures were incubated at 36 C.1 C. for 14 days with periodic microscopic examination for any cytopathic effect (CPE) and/or cellular degeneration. When necessary to maintain the integrity of the cell films, cultures were refed with 2 ml of fresh maintenance medium. Additional groups of 28 roller tubes per tissue culture system were included as uninoculated controls.

On the 7th-8th day of incubation, 6-9 tubes from each series (inoculated and controls) were removed and tested for hemadsorption with 3 red blood cell (RBC) suspensions (guinea pig at 0.1%, chicken at 0.075%, or human at 0.1% in PBS, pH 7.2). Films were rinsed once in the phosphate-buffered saline (PBS) prior to the addition of 1 ml of the RBC suspension employing 2-3 tubes per RBC. Initially, tubes were incubated at 2-8 C. for a minimum of 30 minutes and examined microscopically for any signs of hemadsorption. Following manual shaking, tubes were incubated at 35-37 C. for a minimum of 30 minutes and re-examined microscopically for hemadsorption. All cultures were inactive for hemadsorption with all 3 suspensions and at both temperatures. On day 14, after final microscopic examination, the cultures were divided, depending on the specific tissue culture system for final testing. AGMK, PHA and Fl5000 Tube Cultures were divided as follows:

1. 9 tubes from each series were tested for hemadsorption with the 3RBC suspensions as described above for day 7-8;

2. 4 tubes from each series were fixed and stained with a solution of 5% glutaraldehyde +0.025% crystal violet and, after drying, examined microscopically for any signs of CPE;

3. 8 tubes from each series were challenged with Coxsackie A-9 virus (0.1 ml for each of 2 tubes using a 10-2, 10-3, 10-4 or 10-5 dilution) for the detection of non-CPE producing agents and/or latent agents via the interference phenomenon; and

4. One (1) tube of each series was included as an uninoculated control for the challenge virus.

Vero, PRK and H.Ep-2 Tube Cultures were divided as follows:

1. 12 tubes from each series were tested for hemadsorption with the 3 RBC suspensions as described above for day 7-8;

2. 7 tubes from each series were fixed and stained with a solution of 5% glutaraldehyde +0.025% crystal violet and, after drying, examined microscopically for any signs of CPE.

No challenge studies were carried out with the Coxsackie A-9 virus as this agent does not produce any discernible CPE in these cell systems. The results of these in vitro tissue culture purity and safety assays are summarized in Tables IV-A to F.

TABLE IV-A ______________________________________ Tissue Culture Purity Tests on the AGMK Cell Suspension - Passage 17A, LOT #4742/3 at Approximately 5 105 Cells/ml African Green Monkey Kidney Cells - Passage 12, LOT #4793) Day 7 Results Day 14 Results AGMK Controls AGMK Controls ______________________________________ 0.1% Guinea Pig RBC at 2-8 C. 0/2 0/2 0/3 0/3 at 35-37 C. 0/2 0/2 0/3 0/3 0.075% Chicken RBC at 2-8 C. 0/2 0/2 0/3 0/3 at 35-37 C. 0/2 0/2 0/3 0/3 0.1% Human RBC at 2-8 C. 0/2 0/2 0/3 0/3 at 35-37 C. 0/2 0/2 0/3 0/3 Giemsa Stain 0/4 0/4 Coxsackie A-9 Virus Challenge* at 10-3 2/2 2/2 10-4 2/2 2/2 10-5 2/2 2/2 10-6 2/2 2/2 Unchallenged Controls 0/1 0/1 ______________________________________ *Coxsackie A9 Challenge results based on a 5day incubation at 36 C. Prior to challenge, tubes refed with 2 ml of fresh medium.

TABLE IV-B ______________________________________ Tissue Culture Purity Tests on the AGMK Cell Suspension - Passage 17A, LOT #4742/3 at Approximately 5 105 Cells/ml Primary Human Amnion - (PHA) - (LOT #4720) Day 7 Results Day 14 Results AGMK Controls AGMK Controls ______________________________________ 0.1% Guinea Pig RBC at 2-8 C. 0/2 0/2 0/3 0/3 at 35-37 C. 0/2 0/2 0/3 0/3 0.075% Chicken RBC at 2-8 C. 0/2 0/2 0/3 0/3 at 35-37 C. 0/2 0/2 0/3 0/3 0.1% Human RBC at 2-8 C. 0/2 0/2 0/3 0/3 at 35-37 C. 0/2 0/2 0/3 0/3 Giemsa Stain 0/4 0/4 Coxsackie A-9 Virus Challenge* at 10-3 2/2 2/2 10-4 2/2 2/2 10-5 2/2 2/2 10-6 2/2 2/2 Unchallenged Controls 0/1 0/1 ______________________________________ *Coxsackie A9 Challenge results based on a 5day incubation at 36 C. Prior to challenge, tubes refed with 2 ml of fresh medium.

TABLE IV-C ______________________________________ Tissue Culture Purity Tests on the AGMK Cell Suspension - Passage 17A, LOT #4755 at Approximately 5 105 Cells/ml Vero Cells - (Passage 143, LOT #4813) Day 7 Results Day 14 Results AGMK Controls AGMK Controls ______________________________________ 00.1% Guinea Pig RBC at 2-8 C. 0/3 0/3 0/4 0/4 at 35-37 C. 0/3 0/3 0/4 0/4 0.075% Chicken RBC at 2-8 C. 0/3 0/3 0/4 0/4 at 35-37 C. 0/3 0/3 0/4 0/4 0.1% Human RBC at 2-8 C. 0/3 0/3 0/4 0/4 at 35-37 C. 0/3 0/3 0/4 0/4 Giemsa Stain 0/7 0/7 ______________________________________

TABLE IV-D ______________________________________ Tissue Culture Purity Tests on the AGMK Cell Suspension - Passage 17A, LOT #4889 at Approximately 5 105 Cells/ml Rabbit Kidney Cells - (Primary, LOT #4814) Day 7 Results Day 14 Results* AGMK Controls AGMK Controls ______________________________________ 0.1% Guinea Pig RBC at 2-8 C. 0/4 0/4 0/3 0/3 at 35-37 C. 0/4 0/4 0/3 0/3 0.075% Chicken RBC at 2-8 C. 0/4 0/4 0/3 0/3 at 35-37 C. 0/4 0/4 0/3 0/3 0.1% Human RBC at 2-8 C. 0/4 0/4 0/3 0/3 at 35-37 C. 0/4 0/4 0/3 0/3 Giemsa Stain 0/7 0/7 ______________________________________ *On day 8, tubes refed with 2 ml of fresh medium.

TABLE IV-E ______________________________________ Tissue Culture Purity Tests on the AGMK Cell Suspension - Passage 17A, LOT #4889 at Approximately 5 105 Cells/ml Whole Human Embryo Fibroblast Cells - (FL 5000) - (Passage 22, LOT #4842) Day 7 Results Day 14 Results AGMK Controls AGMK Controls ______________________________________ 0.1% Guinea Pig RBC at 2-8 C. 0/2 0/2 0/2 0/2 at 35-37 C. 0/2 0/2 0/2 0/2 0.075% Chicken RBC at 2-8 C. 0/2 0/2 0/2 0/2 at 35-37 C. 0/2 0/2 0/2 0/2 0.1% Human RBC at 2-8 C. 0/2 0/2 0/2 0/2 at 35-37 C. 0/2 0/2 0/2 0/2 Giemsa Stain 0/4 0/4 Coxsackie A-9 Virus Challenge* at 10-3 2/2 2/2 10-4 2/2 2/2 10-5 2/2 2/2 10-6 1/2 1/2 Unchallenged Controls 0/1 0/1 ______________________________________ *Coxsackie A9 Challenge results based on a 4day incubation at 36 C. Prior to challenge, tubes refed with 2 ml of fresh medium.

TABLE IV-F ______________________________________ Tissue Culture Purity Tests on the AGMK Cell Suspension - Passage 17A, LOT #4755 at Approximately 5 105 Cells/ml Human Carcinoma of the Larynx - H.Ep-2 - (Passage 397, LOT #4808) Day 7 Results Day 14 Results AGMK Controls AGMK Controls ______________________________________ 0.1% Guinea Pig RBC at 2-8 C. 0/3 0/3 0/4 0/4 at 35-37 C. 0/3 0/3 0/4 0/4 0.075% Chicken RBC at 2-8 C. 0/3 0/3 0/4 0/4 at 35-37 C. 0/3 0/3 0/4 0/4 0.1% Human RBC at 2-8 C. 0/3 0/3 0/4 0/4 at 35-37 C. 0/3 0/3 0/4 0/4 Giemsa Stain 0/7 0/7 ______________________________________ *On day 10, tubes refed with 2 ml of fresh medium.

EXAMPLE 6

In Vivo Tests for the Detection of Viable Adventitious Microbial Agents

The following tests were performed employing cell suspensions derived from Passage 17A-(Lots #4706, #4742, #4755 and #4788). These assays were performed with inocula consisting of approximately 1107 cells per ml suspended in the culture medium in which they were grown.

1. Tests in Animals

a. Suckling Mouse Assay

A total of 10 newborn CD-1 mice randomized from different litters (10 per mother, less than 24 hours old) were inoculated intracerebrally (I.Cer.) with 0.01 ml and intraperitoneally (I.P.) with 0.1 ml of the cell suspension from Lot #4706. An additional randomized group of 10 sucklings was inoculated in a similar manner with the original culture medium. A randomized group of 10 sucklings was included as uninoculated controls. All sucklings were observed daily for 14 days for deaths and/or signs of illness or distress. On day 2, one (1) suckling from each of the inoculated groups was found missing and presumed cannibalized. There were no other deaths and none of the sucklings exhibited any signs of illness or distress over this initial 14 day observation period.

On the 14th day, single pools were prepared of the emulsified tissue (minus skin and viscera) of the following groups: (a) AGMK inoculated pups (n=9); (b) culture fluid inoculated pups (n=9); and (c) uninoculated controls (n=10). A blind.passage into newborn CD-1 mice was made of each pool via the I.Cer. and I.P. routes: each pool into 10 newborns from mixed litters. An additional litter of 10 sucklings was included as uninoculated controls for this blind passage. All sucklings were observed daily for 14 days for deaths and/or signs of illness or distress. There were no deaths recorded for the AGMK or culture medium inoculated pups or for the uninoculated control group; however, on day 3, 4 sucklings were missing and presumed cannibalized in (c) the passaged control group. None of the sucklings exhibited any signs of illness or distress over this final 14 day observation period.

Because none of the AGMK cell suspension or culture medium inoculated sucklings exhibited any signs of a transmissible agent or of Coxsackie virus infection or of any viral infection, and because >90% of these inoculated sucklings (19 of 20) remained healthy and survived the entire observation period, this assay in suckling mice was considered satisfactory.

b. Adult Mouse Assay

Each of 20 adult CD-1 mice (VAF, 15-20 grams each) was inoculated I.Cer. and I.P. with 0.03 ml and 0.5 ml, respectively, with the cell suspension Lot #4788. An additional 5 mice were inoculated in a similar manner with the original culture medium. Four mice were included as uninoculated controls. Mice were observed daily for deaths and/or signs of illness or distress over a 21 day period. There were no deaths recorded and all mice survived the entire 21 day observation period with no evidence of lymphocytic choriomeningitis virus infection or any other viral infection. This test in adult mice was considered satisfactory.

c. Adult Guinea Pig Assay

Each of 5 Hartley strain guinea pigs (VAF, 350-450 grams each] was inoculated I.Cer. and I.P. with 0.1 ml and 5.0 ml, respectively, with the cell suspension Lot #4755. An additional guinea pig was inoculated in a similar manner with the original culture medium. One (1) guinea pig was included as an uninoculated control. All were observed daily for deaths and/or signs of illness or distress over a 6 week period; none were recorded. Commencing on day 21, daily rectal temperatures were taken with a digital thermometer and recorded (at approximately 0900 hours) for all guinea pigs until time of sacrifice. The average temperatures ( C.) for the AGMK inoculated guinea pigs were: 39.26, 39.30, 39.40, 39.46 and 39.53; for the medium inoculated guinea pig: 39.32; and for the control: 39.37. There were no significant temperature rises indicative of either bacterial or viral infection. All guinea pigs appeared healthy and survived the entire 42-day observation period at which time they were necropsied following euthanasia with Halothane and exsanguination. Inspection of the abdominal and thoracic cavities by the consulting veterinarian did not identify gross lesions or pathological changes. This assay in adult guinea pigs was considered satisfactory.

d. Adult Rabbit Assay

Each of 5 New Zealand white rabbits (1500-2500 gm each) was inoculated intradermally (I.D.) with 0.1 ml per each of 10 sites and subcutaneously (S.Q.) with 9.0 ml of the AGMK cell suspension Lot #4788. One (1) rabbit was similarly inoculated with the original culture medium. One (1) rabbit was included as an uninoculated control. Animals were observed daily for 28 days for deaths, illness, distress and/or lesions at the sites of inoculation. No deaths were recorded and all rabbits remained healthy without exhibiting any signs of illness or distress or lesions at the sites of inoculation. This test in adult rabbits was considered satisfactory. The results of these in vivo animal safety tests are summarized in Table V-A and B.

2. Tests in Embryonated Eggs

For these studies, specific pathogen-free embryonated eggs were obtained from SPAFAS, Inc., Reinholds, Pa. These eggs came from Flock L061-E.

a. Allantoic Inoculation

Each of ten 10-day old embryonated eggs was inoculated via the allantoic route with 0.5 ml of the AGMK suspension Lot #4706. An additional 5 eggs were inoculated in a similar manner with the original culture medium. Five (5) eggs were included as uninoculated controls. Eggs were incubated at 36 C.1 C. for 72 hours and then candled for deaths (1 of 5 medium inoculated) and chilled overnight at 2-8 C. Allantoic fluids were harvested individually, incubated in a 37 C. water bath for 60 minutes to elute any adsorbed agent(s), and then clarified by centrifugation at 2500 rpm for 15 minutes at 20 C. Pools were prepared for each of the 3 sets of eggs employing equal volumes from each individual harvest. The pools were assayed for hemagglutination both undiluted and at a 1:10 dilution with incubation at 2-8 C. and at room temperature (15-30 C.) using the following erythrocytes in PBS at (pH 7.2): guinea pig at 0.6%; chick at 0.4%; and human at 0.6%. All fluids were negative for hemagglutination at both dilutions and at both temperatures with all 3 RBC suspensions.

The sample pools were subpassaged in 0.5 ml amounts into 10-day old embryonated eggs via the allantoic route as follows: the pool from the AGMK cell suspension into 10 eggs; the pool from the medium into 5 eggs; and the pool from the uninoculated eggs into 5 eggs. An additional 5 eggs were included as uninoculated controls. Eggs were incubated at 36 C.1 C. for 72 hours and then candled for deaths (none recorded) and chilled overnight at 2-8 C. Allantoic fluids were harvested, handled and tested as described above. All 4 pools were negative for hemagglutination at both dilutions and at both temperatures with all 3 RBC suspensions.

There were no deaths recorded for any of the eggs inoculated with the AGMK cell suspension. Since none of the harvest fluids exhibited any hemagglutination when tested against guinea pig, chick or human RBC, this aspect of the embryonated egg study was considered satisfactory.

b. Yolk Sac Inoculation

Each of ten 6-day old embryonated eggs was inoculated into the yolk sac with 0.5 ml of the AGMK cell suspension Lot #4742. Five (5) eggs were similarly inoculated with the original culture medium and 5 eggs were included as uninoculated controls. Eggs were incubated at 36 C. [1 C.] for 9 days with periodic candling for deaths. Of the medium-inoculated eggs, 2 were found dead (1 each on days 2 & 5); and, of the AGMK-inoculated eggs, 2 were inadvertently broken. No other deaths or losses were recorded. Each group of yolk sacs (AGMK group=8; medium group=3; controls=5) was harvested, pooled, washed in PBS, emulsified by grinding and clarified by centrifugation at 2500 rpm for 20 minutes at 20 C.

The 3 clarified suspensions were subpassaged via the same route into fresh 6-day old embryonated eggs as follows: AGMK group into 10 eggs; medium group into 5 eggs; control group into 5 eggs. An additional 5 eggs were included as uninoculated controls. All eggs were incubated at 36 C.1 C. for 9 days with periodic candling for deaths. On day 7, 3 eggs were found dead; 2 from the AGMK group and 1 from the medium group. There were no other deaths recorded.

This aspect of the embryonated egg study was considered satisfactory, because there was a greater than 80% overall survival (16 of 18) of embryonated eggs (primary and subpassage) inoculated with the AGMK cell suspension and viability of the egg was confirmed.

EXAMPLE 7

Use of the Characterized AGMK Cell Substrate for: (1) Isolation and Growth of Human Rotaviruses: and (2) Production of Live Vaccines Containing Such Viruses

The AGMK cells are the only characterized cells tested to date that are suitable for vaccine purposes and support the efficient growth of completely homologous human rotaviruses, i.e., rotaviruses that derive each of their 11 gene segments from a human rotavirus. This is particularly important because a number of candidate homologous human rotavirus vaccine strains are now under development, including those shown in Table V.

As seen in Table V, two candidate human vaccine rotaviruses of G serotype 1 or G serotype 3 recovered from newborn infants were observed to grow to moderately high or high titer in AGMK cells, whereas, each of these neonatal rotavirus strains was markedly restricted in its capacity to grow in two types of cells certified for vaccine production, i.e., FRhL2 or Vero cells. In addition, one of these neonatal rotavirus strains was also markedly restricted in replicative capacity in human fetal fibroblast cell strain MRC-5 which is licensed for vaccine production.

Similar observations were made with two cold-adapted (ca) mutants of human rotavirus of G serotype 1 or G serotype 2 that are also promising candidate live virus vaccine strains. Both human rotavirus mutants grew efficiently in AGMK cells but were significantly or markedly restricted in their growth in certified cells FRhL2 and Vero.

A. Isolation and Serial Passage of Neonatal Human Rotavirus Strains

Initially, the toxicity of each new preparation of purified trypsin is determined for the AGMK cells to be tested. A known positive stool extract is pre-treated with antibiotics (200 ?g/ml gentamicin; 100 ?g/ml neomycin; and 5 ?g/ml fungizone) for 60 minutes at room temperature. Equal volumes of stool extract and trypsin at pre-determined concentration, e.g., 10 ?g/ml, are mixed and allowed to incubate at 37 C. in a water bath for 30 minutes. In the interim, the cultures to be inoculated are washed three times with appropriate volumes (e.g., 3 ml for roller tubes, 10 ml for T25 flasks, 30 ml for T75 flasks and 100 ml T175 flasks) of serum-free medium to dilute the serum that had been in the growth medium in order to prevent components of serum from inactivating trypsin activity.

Roller tube cultures are inoculated with a 0.5 ml volume of the stool/trypsin mixture which is allowed to adsorb at 36 C.1 C. for 60 minutes while rotating on a roller drum apparatus. Cultures are washed once and fed with 3 ml volumes of (EMEM) containing 1% of 10 SPG (sucrose, 2.18M; KH2 PO4, 0.038M; K2 HPO4, 0.072M; and mono-sodium glutamate, 0.054M) and 1 ?g/ml trypsin. Cell cultures in which trypsin is omitted are also included to control for the effect of trypsin. Incubation is at 36 C.1 C.

Cultures are examined microscopically on a daily basis and cultures are harvested when cytopathic effect (CPE) that involves 75 to 100% of the cells is evident. Virus and control cultures are treated similarly with 10% of 10 SPG (v/v) and subjected to one freeze-thaw cycle prior to harvest, sterility testing, distribution for storage, and serial passage. All subsequent passages are carried out either in roller tube cultures or in 25 cm2 flask cultures employing similar procedures but with variation in trypsin concentration in both pre-treatment and in the final overlay.

An efficient system for producing virus plaques in AGMK cells is developed using methods that are routine in the art so that the virus can be plaque purified in order to obtain a homogeneous population of virus for subsequent vaccine development. The harvest fluids are routinely titrated in the simian MA-104 cells to measure the virus yield obtained. The virus is then triply-plaque-purified AGMK cells and the resulting clone is amplified by serial passage in progressively larger tissue culture vessels. The conditions for maximum yield based on trypsin concentration employed in both pre-treatment and final overlay is determined for the progeny of the isolated clone using methods well known in the art.

B. Adaptation and Serial Passage Human Neonatal Rotaviruses or Other Human Rotavirus Strains

The human rotaviruses exhibit a very narrow tissue culture host range. As a consequence, isolation and serial passage of various strains are usually performed in commercially available laboratory cell cultures such as simian MA-104 or primary monkey kidney, both of which are unsuitable for vaccine production. The former cells have not been validated as a substrate for vaccine production and the latter cells are notorious for their contamination with various simian microbial agents including retroviruses. In contrast to MA104 or primary monkey kidney cells, cell substrates certified for vaccine production, such as simian FRhL-2 or Vero cells, either fail to support growth of completely homologous human rotaviruses or allow only poor growth.

Many well characterized rotaviruses have been isolated, serially passaged and triply plaque-purified in commercially available laboratory cell culture systems not suitable for vaccine production. In those instances where it was necessary to use such viruses in vaccine development, the viruses were subsequently passaged and biologically cloned in a cell substrate certified for vaccine development and production. Ideally, virus to be used in vaccines should be isolated and passaged only in tissue culture cells certified to be acceptable for vaccine production. The AGMK cells of this invention meet this requirement because they support efficient growth of fully homologous human rotaviruses (Table V).

To develop a vaccine, routine studies are performed in flask cultures to determine the conditions for maximum yield including trypsin concentration required in both pre-treatment and final overlay. Once adaptation of the vaccine virus to the AGMK cell substrate has been achieved, the virus harvest is treated with ether (1 part ether to 4 parts virus suspension for 60 minutes at room temperature followed by a 30 minute bubbling with N2 to drive off ether) to eliminate any ether-sensitive virus(es) that may have been present in the original clinical specimen or acquired subsequently during passage in cell culture prior to initiation of vaccine development.

Live Virus Vaccine and/or Suspension Production

To produce vaccine, it is preferable also to prepare several backup pools of virus as fellows:

1. Primary Seed Virus Pool

A pool of virus and serially passaged tissue culture control fluids supplemented with 10% of 10 SPG (v/v) are prepared and, after sterility is confirmed, and potency is determined, the fluids are distributed into small aliquots for storage at or below -70 C. to serve as 3rd level back-up to final vaccine production. Total volume may range from 30 ml to 100 ml.

2. Secondary Seed Virus Pool

A pool of virus and serially passaged tissue culture control fluids supplemented with 10% of 10 SPG (v/v) is prepared. After sterility is confirmed, and potency determined, the fluids are distributed into small aliquots for storage at or below -70 C. to serve as 2nd level back-up to final vaccine production. Total volume may range from 100 ml to 300 ml.

3. Master Seed Virus Pool or Pre-Production Seed Virus Pool

A pool of virus and serially passaged tissue culture control fluids supplemented with 10% of 10 SPG (v/v) is prepared. After sterility is confirmed, potency is determined, and identity is confirmed by both serology and electrophoretic pattern, the fluids are distributed into multi-sized aliquots with storage at or below -70 C. These pools serve as first level back-up to final production. These fluids are subjected to the Tissue Culture Purity (Safety) Testing simultaneously with the vaccine lot. Total volume may range from 500 ml to 1 liter.

4. Live Virus Vaccine Production

Volume to be produced is based on the number of doses and containers required plus a minimum of 400 ml of crude fluid for safety testing. In addition to the virus pool, the production of a small pool (200-400 ml) of the passaged tissue culture control fluid is recommended for subsequent safety testing together with the crude virus harvest. Culture vessel fluids supplemented with 10% of 10 SPG (vly) are subjected to one (1) freeze-thaw cycle prior to individual harvest and sterility testing. A sample pool is prepared and assayed for potency. Identity is confirmed by both serology and electrophoretic pattern. The individual harvests are stored at or below -70 C. When sterility, potency and identity are confirmed, crude harvests are thawed and pooled. Samples of about 400 ml are removed for safety testing. The remainder of the fluid is clarified by centrifugation at 1200 g for 20 min. at 5 C., re-pooled, and distributed into final containers.

EXAMPLE 8

Adaptation of Human x Animal Reassortant Rotaviruses To Growth and Serial Passage in the Characterized AGMK Cell Substrate and the Use of Such Cells for Production of Live Virus Vaccines

Live attenuated rotavirus vaccines can be made using reassortant rotaviruses that derive ten of their eleven gene segments from their animal rotavirus parent and only one gene segment from their human rotavirus parent (usually the gene that encodes the major protective antigen VP7). In one instance, human x rhesus monkey rotavirus reassortants are in a late stage of vaccine development and an application for a license has been submitted to the FDA.

All vaccine candidate human X animal reassortant rotaviruses studied to date have exhibited a very broad tissue culture host range attributable to the animal rotavirus parent, which contributes ten of its eleven gene segments to the reassortant. Although these vaccine candidate reassortants can proliferate to high titer in other cell lines certified for vaccine production, comparative studies with the AGMK cell substrate indicate that the AGMK cell substrate provided a significant advantage in viral growth yield over FRhL2 cells in every instance tested (Table V). In addition, the AGMK cell substrate has proved to be superior to Vero cells for the growth of human x rhesus rotavirus reassortants as well as rhesus rotavirus itself (Table V). In these instances, RRV and its human rotavirus reassortants grew in the AGMK cell line to a titer that was 16- to 100-fold higher than in FRhL2 cells and 10- to 1200-fold higher than in Vero cells (Table V). The only instances in which the AGMK cell substrate was not superior to Vero cells involved the human x bovine rotavirus reassortants where viral growth yield in the two cell lines was equivalent (Table V).

In addition to yield, the AGMK cell substrate has other advantages: (a) pre-treatment of virus with trypsin is not required; (b) the concentration of trypsin required in culture medium is reduced; (c) there is a significant reduction in the amount of virus required in the inoculum; (d) incubation time is shortened; and (e) the infected cell monolayer is completely lysed. Vaccine production is carried out as outlined above.

EXAMPLE 9

Adaptation of Human Astrovirus to Growth Serial Passage and Subsequent Live Virus Vaccine Production in the Characterized AGMK Cell Substrate

Previously, all human astroviruses have been isolated or propagated in cells inappropriate or unacceptable for vaccine production. A Type 2 strain of human astrovirus was successfully adapted to growth and serial passage in the AGMK cell substrate from seed virus grown in the simian LLCMK2 cell line. Flask cultures of AGMK cell grown virus were studied to determine the optimal conditions for maximum yield based on trypsin concentrations employed in both pre-treatment and final overlay. Once adaptation was achieved, the virus harvest was treated with ether (1 part ether to 4 parts virus suspension for 60 minutes at room temperature followed by a 30 minute bubbling with N2 to drive off ether) to eliminate any ether sensitive simian virus that may have been picked up during passage and plaquing in the commercially available laboratory cell culture systems. Fluid production was similar to that outlined for the human rotavirus.

EXAMPLE 10

Propagation of Live Attenuated Poliovirus Vaccine Strains in the Characterized AGMK Cell Substrate

The Sabin live attenuated oral poliovirus vaccine strains were grown in the AGMK cells at passages 15 and 16. Each of the vaccine strains grew to high titer in AGMK cells (type 1 virus 108.3 TCID50 /ml, type 2 virus 108.1 TCID50 /ml, and type 3 virus 108.6 TCID50 /ml). These titers translate into 100 to 1000 vaccine doses per ml of tissue culture harvest and are equivalent to the amount of virus produced by licensed primary AGMK cells and MRC-5 cells.

EXAMPLE 11

Isolation and/or Adaptation of Enteroviruses to Growth, Serial Passage and Subsequent Live Virus Suspension and/or Vaccine Production in the Characterized AGMK Cell Substrate

Enteroviruses such as Coxsackie A9 virus were adapted to growth and serial passage in the characterized AGMK cells. These cells are used to produce live virus suspensions and vaccine. Several seed virus pools have been produced.

Live Virus Vaccine and/or Suspension Production

1. Primary Seed Virus Pool

A pool of virus and serially passaged tissue culture control fluids supplemented with 10% of 10 SPG (v/v) are prepared and after sterility is confirmed and potency is determined, the fluids are distributed into small aliquots for storage at or below -70 C. to serve as 3rd level back-up to final vaccine production. Total volume may range from 30 ml to 100 ml.

2. Secondary Seed Virus Pool

A pool of virus and serially passaged tissue culture control fluids supplemented with 10% of 10 SPG (v/v) are prepared. After sterility is confirmed, and potency determined, the fluids are distributed into small aliquots for storage at or below -70 C. to serve as 2nd level back-up to final vaccine production. Total volume may range from 100 ml to 300 ml.

3. Master Seed Virus Pool or Pre-Production Seed Virus Pool

A pool of virus and serially passaged tissue culture control fluids supplemented with 10% of 10 SPG (v/v) are prepared. After sterility is confirmed, potency is determined, and identity confirmed by serology. The fluids are distributed into multi-sized aliquots with storage at or below -70 C. These pools serve as first level back-up to final production. These fluids are subjected to the Tissue Culture Purity (Safety) Testing simultaneously with the vaccine lot. Total volume may range from 500 ml to 1 liter.

4. Live Virus Vaccine Production

Volume to be produced is based on the number of doses and containers needed plus a minimum of 400 ml of crude fluid for the required safety testing. In addition to the virus pool, the production of a small pool (200-400 ml) of the passaged tissue culture control fluid is recommended for subsequent safety testing together with the crude virus harvest. Culture vessel fluids supplemented with 10% of 10 SPG (v/v) are subjected to one (1) freeze-thaw cycle prior to individual harvest and sterility testing. A sample pool is prepared and assayed for potency and identity is confirmed by serology. The individual harvests are stored at or below -70 C. When sterility, potency and identity are confirmed, crude harvests are thawed and pooled. Samples of about 400 ml are removed for safety testing. The remainder of the fluid is clarified by centrifugation at 1200 g for 20 min. at 5 C., re-pooled, and distributed into final containers.

EXAMPLE 12

Isolation and Adaptation of Respiratory Syncytial Virus (RSV) to Growth and Serial Propagation in the Characterized AGMK Cell Substrate and Use of These Cells for Production of a Live Virus Vaccine

Respiratory syncytial viruses, subgroup A and B types, have been readily isolated in these AGMK cell cultures directly from human nasal and/or throat secretions. Specimens are centrifuged at 3000 rpm for 10 minutes to remove any particulate matter and then treated with antibiotics (200 ?g/ml gentamicin; 100 ?g/ml neomycin; and 5 ?g/ml fungizone) for 60 minutes at room temperature. The antibiotic-treated specimens are inoculated into roller tube cultures of the AGMK cells and incubated at 36 C.1 C. on a roller drum. Once cytopathic effects are evident, cultures are harvested and further passages are carried out either in roller tubes or in flask cultures with subsequent serial passage and plaque purification. Subsequently, virus mutants are produced by chemical mutagenesis or are selected by passage at suboptimal temperature using the AGMK cells in either instance. Live virus vaccine is then prepared using the AGMK cells.

Final viral yield of candidate live attenuated RSV vaccine strains grown in the AGMK cells was greater than that of these viruses grown in Vero cells, which were previously the most efficient cell substrate certified for production of RSV vaccines. An example is seen in Table VI, where the virus yield of a cold-passaged, temperature sensitive mutant of RSV (designated RSV A2 cpts248/404) is shown to be 4- to 16-fold higher in the AGMK cell line than in Vero cells. Also, the amount of RSV produced by the human fetal diploid cell line MRC-5, which has been licensed for use in production of virus vaccines, is 10- to 100-fold less than in AGMK cells. This mutant is highly attenuated but still capable of inducing resistance to RSV in susceptible chimpanzees, which represent the most relevant animal surrogate for evaluation of attenuation and protective efficacy of RSV mutants prior to initiation of clinical trials in humans.

Live attenuated RSV vaccines are designed to be used in very young infants, the population at greatest risk of life-threatening RSV disease. Because of the need to immunize such young individuals, the live vaccine must be very attenuated (i.e., demonstrably weakened). Thus, it is noteworthy that the RSV A2 cpts248/404 mutant was able to attain a high titer in AGMK cells. Clearly, success of a vaccine containing this mutant and live RSV vaccines in general will require attainment of a high level of viral yield.

To produce live virus vaccine, conditions for good growth and viral yield, such as temperature of incubation and inoculum size, are determined by routine methods with production proceeding as follows:

Live Virus Vaccine and/or Suspension Production

1. Primary Seed Virus Pool

A pool of virus and serially passaged tissue culture control fluids supplemented with 10% of 10 SPG (v/v) are prepared and after sterility is confirmed and potency is determined, the fluids are distributed into small aliquots for storage at or below -70 C. to serve as 3rd level back-up to final vaccine production. Total volume may range from 30 ml to 100 ml.

2. Secondary Seed Virus Pool

A pool of virus and serially passaged tissue culture control fluids supplemented with 10% of 10 SPG (v/v) is prepared. After sterility is confirmed, and potency determined, the fluids are distributed into small aliquots for storage at or below -70 C. to serve as 2nd level back-up to final vaccine production. Total volume may range from 100 ml to 300 ml.

3. Master Seed Virus Pool or Pre-Production Seed Virus Pool

A pool of virus and serially passaged tissue culture control fluids supplemented with 10% of 10 SPG (v/v) are prepared. Sterility is confirmed, potency is determined, and identity confirmed by serology. The fluids are distributed into multi-sized aliquots with storage at or below -70 C. These pools serve as first level back-up to final production. These fluids are subjected to the Tissue Culture Purity (Safety) Testing simultaneously with the vaccine lot. Total volume may range from 500 ml to 1 liter.

4. Live Virus Vaccine Production

Volume to be produced is based on the number of doses and containers needed plus a minimum of 400 ml of crude fluid for the required safety testing. In addition to the virus pool, the production of a small pool (200-400 ml) of the passaged tissue culture control fluid is recommended for subsequent safety testing together with the crude virus harvest. Culture vessel fluids supplemented with 10% of 10 SPG (v/v) are harvested directly without undergoing a freeze-thaw cycle. A sample pool is prepared and assayed for potency and identity is confirmed by serology. The crude harvests are pooled and aliquots of about 400 ml are removed for safety testing. The remainder of the fluid is clarified by centrifugation at 1200 g for 20 min. at 5 C., re-pooled, and distributed into final containers.

EXAMPLE 13

Isolation and Adaptation of Parainfluenza Viruses to Growth and Serial Propagation in the Characterized AGMK Cell Substrate and Use of These Cells for Production of a Live Virus Vaccine

Parainfluenza viruses types 1, 2 and 3 were isolated previously in primary AGMK cell cultures directly from human nasal and/or throat specimens. Subsequently, virus types 1, 2 and 3 were readily adapted to growth in the characterized AGMK cells. For isolation in the characterized AGMK cell substrate clinical specimens are centrifuged at 3000 rpm for 10 minutes to remove any particulate matter and then treated with antibiotics (200 ?g/ml gentamicin; 100 ?g/ml neomycin; and 5 ?g/mI fungizone) for 60 minutes at room temperature. The antibiotic-treated specimens are inoculated into the AGMK cell substrate roller tube cultures and incubated at 36 C.1 C. on a roller drum. Once cytopathic effects and/or hemadsorption (with 0.1% guinea pig RBC in PBS, pH 7.2) is evident, cultures are harvested with further passages carried out either in roller tubes or in flask cultures with subsequent serial passage followed by plaque purification. Subsequently, virus mutants are produced by chemical mutagenesis or are selected by passage at suboptimal temperature, using the AGMK cell substrate in either instance.

An attenuated cold-adapted (ca) mutant of parainfluenza virus type 3 (designated PIV3 ca cold passage 45) was successfully grown to high titer in the AGMK cell substrate. Growth yield of the mutant was similar to the yield obtained in Vero cells, a certified simian cell line that has not yet been licensed for production of live virus vaccine for use in humans. However, as shown in Table VII, final viral yields in the AGMK cells were approximately 30-fold higher than in the commonly used, certified fetal rhesus lung cell strain, FRhL-2, which also has not been licensed as yet for production of human viral vaccines.

The PIV3 ca cold passage 45 mutant, which is now in Phase II clinical trials, is satisfactorily attenuated for young infants who have not been previously infected with naturally occurring PIV3. Although the mutant is very attenuated in young infants, it nonetheless stimulates production of protective levels of serum PIV3 antibodies. Based upon the results of clinical trials of the ca mutant in young infants, we calculate that 1 ml of the viral yield from infected AGMK cells contains 30 vaccine doses of PIV3 ca cold passage 45. Attainment of this level of viral growth during vaccine production is particularly noteworthy because the live PIV3 vaccine virus has been weakened so that is can be administered safely to infants and young children, the target population for immunization.

To produce live virus vaccine, conditions for good growth and viral yield, such as temperature of incubation and inoculum size, are determined by routine methods with production proceedings as follows:

Live Virus Vaccine and/or Suspension Production

1. Primary Seed Virus Pool

A pool of virus and serially passaged tissue culture control fluids supplemented with 10% of 10 SPG (v/v) are prepared and, after sterility is confirmed and potency is determined, the fluids are distributed into small aliquots for storage at or below -70 C. to serve as 3rd level back-up to final vaccine production. Total volume may range from 30 ml to 100 ml.

2. Secondary Seed Virus Pool

A pool of virus and serially passaged tissue culture control fluids supplemented with 10% of 10 SPG (v/v) is prepared. After sterility is confirmed, and potency determined, the fluids are distributed into small aliquots for storage at or below -70 C. to serve as 2nd level back-up to final vaccine production. Total volume may range from 100 ml to 300 ml.

3. Master Seed Virus Pool or Pre-Production Seed Virus Pool

A pool of virus and serially passaged tissue culture control fluids supplemented with 10% of 10 SPG (v/v) are prepared. Sterility is confirmed, potency is determined, and identity confirmed by serology. The fluids are distributed into multi-sized aliquots with storage at or below -70 C. These pools serve as first level back-up to final production. These fluids are subjected to the Tissue Culture Purity (Safety) Testing simultaneously with the vaccine lot. Total volume may range from 500 ml to 1 liter.

4. Live Virus Vaccine Production

Volume to be produced is based on the number of doses and containers needed plus a minimum of 400 ml of crude fluid for the required safety testing. In addition to the virus pool, the production of a small pool (200-400 ml) of the passaged tissue culture control fluid is recommended for subsequent safety testing together with the crude virus harvest. Culture vessel fluids supplemented with 10% of 10 SPG (v/v) are subjected to one (1) freeze-thaw cycle prior to individual harvest and sterility testing. A sample pool is prepared and assayed for potency and identity. The individual harvests are stored at or below -70 C. When sterility, potency and identity are confirmed, crude harvests are thawed and pooled. Samples of about 400 ml are removed for safety testing. The remainder of the fluid is clarified by centrifugation at 1200 g for 20 min. at 5 C., re-pooled, and distributed into final containers.

EXAMPLE 14

Isolation and/or Adaptation of Influenza Viruses to Growth in the Characterized AGMK Cell Substrate and Use of These Cells for Production of a Live or Inactivated Virus Vaccine

Influenza viruses type A, subtypes H3N2, and H1N1 and type B, have been readily adapted to growth in this characterized AGMK cell line. A significant advantage of isolating and growing influenza viruses in a mammalian cell line rather than in embryonated chicken eggs stems from the fact that the hemagglutinin (the major protective viral protein of influenza virus) retains the same amino acid sequence and conformation as that present in a virus isolated from humans. In contrast, mutants bearing mutations affecting the hemagglutinin are selected during adaptation of virus to growth in eggs. These mutations confer upon the mutant a growth advantage in eggs.

The advantages of producing influenza virus vaccines, either live or killed, in a mammalian tissue culture system rather than in embryonated eggs derive from retention of the major protective antigenic sites on the influenza virus hemagglutinin (HA) when virus is grown in mammaliam tissue culture. Adaptation of influenza A or B virus to efficient growth in embryonated chicken eggs frequently results in selection of viral mutants that possess mutations affecting one of the major protective antigenic sites on the viral HA. Loss of such an HA epitope that induces protective antibodies diminishes the effectiveness of a vaccine containing this form of viral antigenic mutant. A number of studies have shown that influenza viruses isolated and propagated only in mammalian cell culture are more closely related antigenically to naturally circulating viruses than are egg-adapted influenza virus strains. For this reason it would be advantageous to isolate and maintain influenza A and B virus vaccine strains in a mammalian cell culture system, preferably primate, so as to maintain authentic antigenic structure of HA which is the major protective protein of these viruses.

As shown in Table VIII, a variety of influenza A viruses of subtype H1N1 or H3N2 grew efficiently in the AGMK cell substrate. Various influenza B virus strains also grow in the AGMK cells, albeit somewhat less well than the influenza A viruses. Since egg-propagated viruses were used as the inoculum in this experiment, the viral yields shown in Table VIII are minimal estimates because egg adaptation would be expected to select for mutants able to grow efficiently in eggs. Such mutants often grow less well in primate cells than the original naturally occurring virus as a consequence of the mutations responsible for egg adaptation.

The AGMK cells can be used to isolate influenza A and B viruses from infected humans and serve as a cell substrate for production of virus that is used to produce an inactivated vaccine. Alternatively, the AGMK cells can be used to isolate and propagate virus during the derivation of attenuated mutants that are used for formulation of a live attenuated virus vaccine.

EXAMPLE 15

Isolation and/or Adaptation of Human and Simian Hepatitis A Viruses to Growth Serial Passage and Subsequent Live and Inactivated Virus Vaccine Production in the Characterized AGMK Cell Substrate

Wild-type hepatitis A virus strains of human origin grow poorly or not at all in cell culture on primary isolation: they must be adapted to grow efficiently in cell culture by the laborious procedure of serial passage. In contrast, wild-type HAV of simian origin replicates moderately well during primary isolation in certain primate cells. However, certified or licensed cell culture systems suitable for primary isolation and adaptation of HAV strains of human or simian origin are not readily available or do not support the replication of HAV to high levels. Although the examples are for human HAV, it will be obvious to one skilled in the art that the techniques can be applied to HAV strains of simian origin.

Human hepatitis A virus, strain HM-175 (HAV/7), a strain suitable for a candidate live attenuated vaccine as well as a candidate inactivated vaccine, was compared for ability to replicate in AGMK cells, FRhK-4 (clone 11-1, the most sensitive cell line for replicating this virus to date), and licensed MRC-5 human diploid cells. Conditions for cell culture were those commonly used for the replication of HAV in FRhK4 cells.

As seen in Table IX and FIG. 3, HAV replicated to the same titer and at the same rate in the AGMK cell substrate, which is suitable for vaccine development and production, as in FRhK-4, clone 11-1 cells, which are not suitable for vaccine development. Furthermore, the size of the HAV plaques, as measured by the radioimmunofocus assay, was the same in both cell types. In contrast, HAV strain HM-175 (HAV/7) did not replicate efficiently in MRC5 cells (a cell strain licensable for vaccine development) without extensive adaptation by serial passage.

Live Virus Vaccine and/or Suspension Production

1. Primary Seed Virus Pool

A pool of virus and serially passaged tissue culture control fluids supplemented with 10% of 10 SPG (v/v) are prepared and after sterility is confirmed and potency is determined, the fluids are distributed into small aliquots for storage at or below -70 C. to serve as 3rd level back-up to final vaccine production. Total volume may range from 30 ml to 100 ml.

2. Secondary Seed Virus Pool

A pool of virus and serially passaged tissue culture control fluids supplemented with 10% of 10 SPG (v/v) are prepared. After sterility is confirmed and potency determined, the fluids are distributed into small aliquots for storage at or below -70 C. to serve as 2nd level back-up to final vaccine production. Total volume may range from 100 ml to 300 ml.

3. Master Seed Virus Pool or Pre-Production Seed Virus Pool

A pool of virus and serially passaged tissue culture control fluids supplemented with 10% of 10 SPG (v/v) is prepared. Sterility is confirmed, potency is determined, and identity confirmed by serology. The fluids are distributed into multi-sized aliquots with storage at or below -70 C. These pools serve as first level back-up to final production. These fluids are subjected to the Tissue Culture Purity (Safety) Testing simultaneously with the vaccine lot. Total volume may range from 500 ml to 1 liter. 4. Live Virus Vaccine Production

Volume to be produced is based on the number of doses and containers needed plus a minimum of 400 ml of crude fluid for the required safety testing. In addition to the virus pool, the production of a small pool (200-400 ml) of the passaged tissue culture control fluid is recommended for subsequent safety testing together with the crude virus harvest. Culture vessel fluids supplemented with 10% of 10 SPG (v/v) are subjected to one (1) freeze-thaw cycle prior to individual harvest and sterility testing. A sample pool is prepared and assayed for potency and identity. The individual harvests are stored at or below -70 C. When sterility, potency and identity are confirmed, crude harvests are thawed and pooled. Samples of about 400 ml are removed for safety testing. The remainder of the fluid is clarified by centrifugation at 1200 g for 20 min. at 5 C., re-pooled, and distributed into final containers.

Inactivated Virus Vaccine and/or Suspension Production

1. Primary Seed Virus Pool

A pool of virus and serially passaged tissue culture control fluids supplemented with 10% of 10 SPG [v/v] that are sterility confirmed, potency determined and distributed into small aliquots for storage at -70 C., or below, to serve as 3rd level back-up to final vaccine production. Total volume may range from 30 ml to 100 ml.

2. Secondary Seed Virus Pool

A pool of virus and serially passaged tissue culture control fluids supplemented with 10% of 10 SPG [v/v] that are sterility confirmed, potency determined and distributed into small aliquots with storage at -70 C., or below, to serve as 2nd level back-up to final vaccine production. Total volume may range from 100 ml to 300 ml.

3. Master Seed Virus Pool or Pre-Production Seed Virus Pool

A pool of virus and serially passaged tissue culture control fluids supplemented with 10% of 10 SPG [v/v] that are sterility confirmed, potency determined, identity confirmed, and distributed into multi-sized aliquots with storage at -70 C., or below. Pools serve as 1st level back-up to final production. Fluids to be subjected to the Tissue Culture Purity (Safety) Testing simultaneously with the vaccine lot. Total volume may range from 500 ml to 1 liter.

4. Inactivated Virus Vaccine Production

Volume to be produced is based on the number of doses and containers contracted for plus a minimum of 400 ml of crude fluid needed for the required safety testing. In addition to the virus pool, the production of a small pool [200-400 ml] of the passaged tissue culture control fluid is recommended for subsequent safety testing together with the crude virus harvest. Culture vessel fluids supplemented with 10% of 10 SPG [v/v] are subjected to one (1) freeze-thaw cycle prior to individual harvest and sterility testing. A sample pool is prepared and assayed for potency and identify and the individual harvests stored at -70 C., or below. When sterility, potency and identity are confirmed, crude harvests are thawed, pooled, clarified and purified before inactivation with formalin under standard conditions. The vaccine is then distributed into final containers and safety-tested for sterility.

The novel African Green Monkey Kidney cell line described, supra, was deposited with the American Type Culture Collection on Nov. 4, 1994, and accorded ATCC Designation No. CRL 11756. This deposit was made in accordance with the Budapest Treaty. This cell line will be irrevocably, and without restriction or condition, released to the public upon the issuance of a patent to this application.

TABLE V ______________________________________ Comparison of Growth Patterns of Candidate Rotavirus Vaccines in Various Cell Cultures Titer of Indicated Candidate Live Vaccine Virus Strain Produced Candidate Rotavirus in Indicated Cell Culture as Determined Vaccine Strain by Plaque Assay in MA104 Cells (log10 pfu/ml)a (Serotype)b AGMKc FRhL-2 Veroc MRC5c ______________________________________ Human Strains D - ca30 C. 6.1 No Growth 4.7 NTe (G1;P1A)d DS-1 - ca30 C. 6.3 No Growth No Growth NT (G2;P1B)d M37-neonatal 5.2 No Growth No Growth NT (G:1;P2) Neonatal (G3;P2) 5.8 Inconsistent, Inconsistent, No Growth poor growth poor growth Human Bovine Viral Reassortantsf D UK (G1;P7) 7.1 5.8 7.1 NT DS-1 UK (G2;P7) 7.3 5.3 7.0 NT P UK-2 (G3;P7) 7.0 5.4 6.9 NT ST-3 UK-2 7.2 5.8 6.6 NT (G4;P7) Rhesus Rotavirus or Human Rhesus Monkey Viral Reassortantsf D RRV (G1;P5B) 7.9g 6.7 6.6g NT 7.9 5.7 8.3 5.1 DS-1 RRV 7.6g 5.7 6.6g NT (G2;P5B) 7.6 6.1 7.7 4.8 RRV-2 (G3;P5B) 8.5g 6.7 7.2g NT 8.6 7.3 8.7 6.4 ST3 RRV 7.6g 6.1 6.3g NT (G4;P5B) 7.8 5.8 7.7 4.6 ______________________________________ a Virus suspension grown in indicated cells. b Serotype denotes viral outer capsid proteins (G and P) that induce protective neutralizing antibodies. c AGMK = African green monkey kidney cells (derived from Cercopithecus ethiopus monkey); FRhL2 = Fetal rhesuslung cells; MRC5 = fibroblastic cells derived from fetal human lung. FRhL2 and MRC5 are semicontinuous cell strains and can not be used beyond passage 32 for vaccine production; Vero is a continuous cell line; the number of times AGMK cells can be passaged serially and remain suitable for use in # vaccine development has not been determined yet but is at least 16. d Coldadapted (ca) mutants of human rotavirus selected by growth and serial passage in cell culture at suboptimal temperature that does not allow efficient growth of naturally occurring (i.e., wild type) human rotavirus. e NT = not tested. f A single gene (encoding G serotype) derived from human rotavirus and all the remaining 10 genes derived from bovine or rhesus rotavirus. g Growth yield from second passage in AGMK or Vero cells of virus previously passaged in FRhL2 cells; values shown indicate growth yield from cell culture inoculated with 1:10; 1:00 or 1:1000 dilution of first passage material, respectively. Note: AGMK cells were used at passages 10, 11, 14 or 15.

TABLE VI ______________________________________ Efficient Replication of a Candidate Live Attenuated RSV Vaccine Strain (RSV A2 cpts248/404) in AGMK Substrate Quantity of Virus Vero Cell Grown RSV (Log10 pfu/ml) Pro- A2 cpts248/404 duced in Cell Cultures Used to Initiate Inoculated With* Infection in 1 ml 5 ml ______________________________________ Vero Cells 5.80 5.59 AGMK Cells 6.43 6.80 ______________________________________ *RSV A2 cpts248/404 mutant grown and titrated at 32 C. Titrations performed in HEp2 cells at 32 C. Note: AGMK cells used at passages 14 and 15.

TABLE VII ______________________________________ Efficient Replication of a Candidate Live Attenuated Parainfluenza Virus Type 3 Vaccine Strain (PIV3 Cold-Adapted Cold Passage 45) in AGMK Cell Substrate Temperature Cell Substrate Quantity of Hemagglutinin of Incubation Used for Virus Producedb Titer of PIV3 ca cp45 Virus Growtha (Log10 pfu/ml) (Reciprocal) ______________________________________ 32 C. AGMK 7.37 256 Vero 7.05 256 30 C. AGMK 7.49 256 Vero 7.22 128 26 C. AGMK 7.54 256 Vero 7.78 512 ______________________________________ a Inoculum was FRhL2 cell grown virus currently being evaluated in clinical trials. The titer of this FRbL2 cell virus suspension was 106.0 pfu/ml. b Inoculated cell cultures harvested after 14 days of incubation except 32 C. AGMK cultures which were harvested at 7 days because of accelerated development of viral cell destructive effects. Note: AGMK cells used at passages 13 and 14.

TABLE VIII ______________________________________ Growth of Human Influenza A and B Viruses in AGMK Cell Substrate Quantity of Virus Produced at the highest passage level as Determin- Number of ed by Titration Passages in in Indicated Type and AGMK Cells Cell Substrate Subtype Virus Strain at 36 C.a AGMK MDCKb ______________________________________ A H3N2 A/Wash/897/80 1 6.05 6.60 A/Korea/1/82 3 7.15 7.79 A/Bethesda/1/85 2 6.48 6.90 A/Los Angeles/2/87 3 7.16 7.76 A/Shandung/9/93 3 7.28 7.78 A H1N1 A/Texas/1/85 1 5.31 4.87 A/Kawasaki/9/86 3 6.50 6.81 A/Texas/36/91 1 5.23 6.04 B B/Texas/1/84 1 <3.00 4.78 B/Ann Arbor/1/86 1 3.78 5.58 B/Victoria/2/87 1 <3.00 4.82 B/Yamagata/16/86 1 4.41 5.72 ______________________________________ a Passage in AGMK cell substrate initiated with egg grown influenza virus at a dilution of 10-3 or 10-4. The inoculum for passage i cell culture was also 10-3 or 10-4 (except B/Victoria/2/87 whic was 10-2) in order to minimize generation of defective, interfering virus particles. Tissue culture medium and agarose overlay in plaque assays contained 0.5 ?g/ml of trypsin. b MDCK is a continuous cell line of canine kidney cells often used for titration of human influenza viruses.

TABLE IX ______________________________________ Ability of AGMK Cells to Support Efficient Growth and Plaque Formation of Candidate Hepatitis A Virus Vaccine Strain HM-175 (HAV/7)* Cell Culture Used for Virus Replication HAV Property AGMKa FRhK-4(11-1)a MRC-5a ______________________________________ Titer (log10 pfu/ml) 7.4 7.4 Little or of Virus Achieved in No Growthc Inoculated Cultureb Plaque Size Large Large -- ______________________________________ *Candidate strain for both inactivated and live attenuated HAV vaccines. a AGMK = African green monkey kidney derived from Freeze #2129. FRhK4(11-1) = HAVpermissive cell clone derived from fetal rhesus kidney4 cells (Funkhouser AW, Purcell RH, D'Hondt E, Emerson SU, Attenuated hepatitis A virus: Genetic determinants of adaptation to growth in MRC5 cells. J Virol 68:148-157; 1994). MRC5 = fetal human lung fibroblast cell substrate. b Determined by plaque assay on AGMK and FRhK4(111) cells. c Growth not detected by plaque assay performed with FRhK4(11-1) cel culture. Note: AGMK cells used at passages 12, 13, 15 and 16.

__________________________________________________ ________________________ # SEQUENCE LISTING - - - - (1) GENERAL INFORMATION: - - (iii) NUMBER OF SEQUENCES: 4 - - - - (2) INFORMATION FOR SEQ ID NO:1: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:1: - - CCTCAGAGCT GCATAAAAGC AGAT - # - # 24 - - - - (2) INFORMATION FOR SEQ ID NO:2: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:2: - - TCACTCAAGT CCCTGTTCGG GCGC - # - # 24 - - - - (2) INFORMATION FOR SEQ ID NO:3: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:3: - - TACTAGGAGA CCAGCTTGAG CCTG - # - # 24 - - - - (2) INFORMATION FOR SEQ ID NO:4: - - (i) SEQUENCE CHARACTERISTICS: (A) LENGTH: 24 base - #pairs (B) TYPE: nucleic acid (C) STRANDEDNESS: single (D) TOPOLOGY: linear - - (ii) MOLECULE TYPE: DNA (genomic) - - (xi) SEQUENCE DESCRIPTION: SEQ ID NO:4: - - TGCTGGAGTT TCTCTCGCCT GGGT - # - # 24 __________________________________________________ ________________________

* * * * * Other References



Horaud, Biologicals, vol. 23: pp. 225-228, Sep. 199

http://www.patentstorm.us/patents/6117667/description.html

Peter Lemkin
08-06-2009, 08:02 AM
Roll-up your arm and bend over.

Jan Klimkowski
08-07-2009, 06:01 PM
Ministers plan swine flu vaccination in every school

Biggest mass immunisation in 45 years would cover all 8.5m pupils

Denis Campbell and James Sturcke guardian.co.uk, Thursday 6 August 2009

All 8.5 million pupils in the UK would be immunised against swine flu at immunisation posts in every school, under plans being studied by ministers, the Guardian has learned.

In the biggest mass vaccination since the 1964 operation against smallpox, school nurses, health visitors and GPs would deliver the injections to five- to 16-year-olds at all 33,700 schools. The move would be part of a concerted government effort to minimise the harm caused by the expected second wave of the pandemic this autumn.

"The general principle of schools being the ideal, logical place to do this is well established. They have captive audiences," said one senior source involved in Whitehall planning.

While written parental approval would be necessary, high demand is expected, as long as the vaccine has been declared to be safe. However, the huge scale of the task has led to questions about whether there would be enough health professionals available to administer the jabs. For example, there are just 1,447 school nurses for the 25,000 schools in England.

The move comes as fresh doubts about the government's H1N1 preparedness timetable were raised yesterday when the World Health Organisation said that a clinically tested flu vaccine would not be ready this month, contrary to ministerial assurances.

Dr Marie-Paule Kieny, director of the WHO vaccine research initiative, said results from clinical tests on a new vaccine were not expected until September. Vaccines would then require regulatory clearance before being given to patients in Europe.

Her remarks cast serious doubt on a number of statements by the health secretary, Andy Burnham, and the chief medical officer, Sir Liam Donaldson, who have said the vaccine will be available this month. A Department of Health spokeswoman said: "The manufacturers have told us that we can expect the first supplies of the vaccine from Baxter in August and from GlaxoSmithKline later in September. This is not the DH's schedule it is led by the manufacturers." But GSK admitted that it has yet to start clinical trials on people. "We are still at the discussion stage and are not putting a date on when clinical tests will start," a spokesman said.

The first wave of the pandemic appears to be on its way out. The number of new cases of swine flu in England and Scotland has fallen significantly, according to figures released by the Health Protection Agency yesterday. England recorded an estimated 30,000 new cases last week, down from 110,000 the week before, and in Scotland the estimated number of new cases fell from 1,500 to 1,050. Nine more people in England have died, taking the death toll to 36. Donaldson warned against complacency and said he was "pretty certain" of a second wave in the autumn.

The vulnerability of children to the H1N1 virus, the need to keep the pressure off family doctors' surgeries, and easy access to so many young people means schools are likely to be used. Vaccinating a primary school might take several hours but a secondary school several days.

Experts believe the second wave may start building up in England once schools return in September. But inoculation of pupils could not start until large supplies of the vaccine are available which would be the start of October at the earliest, say health department sources. They also say that under-fives, another priority group, will be immunised at GPs' surgeries.

The Department of Health said last night that the exact form of the immunisation strategy has not yet been agreed. "We have not said that schools will deliver the vaccination programme for swine flu. Decisions have not been made on how the vaccine programme will be delivered, and the chief medical officer has said that he expects GPs to be the bedrock of the programme," the spokeswoman said.

http://www.guardian.co.uk/world/2009/aug/06/mass-immunisation-swine-flu-schools

So, They are, in the words of the song, making plans for Nigel.....

A few random observations.

With the British govt having poured huge amounts of taxpayer money into the salivating snout of Big Pharma, it's now being suggested that a good way of justifying this outrage would be to immunize a captive group: school kids.

Efficacy testing of the vaccine will be minimal before immunization.

Medium and long-term safety testing will be entirely absent.

If the virus mutates, the current vaccine will be entirely useless.

Unless there's something They're not telling us, swine flu has killed only a handful of people who did not have major pre-existing medical conditions.

Preliminary conclusion: vaccinating 8.5 million schoolchildren would serve no proper public health purpose and expose an entire generation to unknown and unknowable risks.

Even on The Man's favourite Risk-Benefit Analysis, the potential risk clearly outweighs the potential benefit.

Message to TPTB: (in the words of another song) Go Straight To Hell.

Dawn Meredith
08-09-2009, 02:24 PM
It's just amazing, they just want to kill us all and appear to want us to know in advance and that there isn't a thing we can do. I think this is what is meant by "hell on earth".
Dawn

Ed Jewett
08-09-2009, 04:50 PM
It's just amazing, they just want to kill us all and appear to want us to know in advance and that there isn't a thing we can do. I think this is what is meant by "hell on earth".
Dawn

It is the stinking, rotting arrogance of it all. Closely related, is it?, to what has been said about the incredible boldness and designed psychic numbing inherent in gunning down JFK in the sunlight of Dealey Plaza, or the open "live on network TV" events of 9/11, or the open temerity of dozens of lesser events. They know we know and they wants us to know that we know they know, and they think there isn't anything that anyone can do about it.

Ed Jewett
08-09-2009, 05:15 PM
Sun, August 9, 2009

Pneumonic plague has killed three during a recent outbreak which began at the end of July in Ziketan, North West China. Pneumonic plague is extremely rare, but is the most deadly type of plague. Since the start of the outbreak, nine additional human infections with Yersinia pestis, the bacteria which causes plague, have been confirmed in this Tibetan Area of Qinghai Province. The threat of disease spread was considered serious enough that the Chinese authorities took aggressive measures to keep 10,000 inhabitants of Qinghai province under quarantine. Media reports suggest that these restrictions have now been lifted.

Lets be clear that this outbreak represents neither a disease pandemic nor an epidemic, so perhaps it may not warrant top headline status. Annually, between 1,000 and 3,000 human Y. pestis infections are reported to the World Health Organisation (WHO) 1. News of the current outbreak has largely been relegated to short paragraphs in world news sections for any number of reasons. Limited access to information about this outbreak in this remote Chinese province may provide some explanation for the lack of media attention, as may the limited number of cases, the relative frequency of similar small plague outbreaks and the existing public health media focus on the swine flu pandemic.

Y. pestis has adapted to exist in rodents with various degrees of symptomatic illness; in some rodent hosts the bacteria can circulate without any ill-effect. As such, animals including rats, mice, ground squirrels, chipmunks and marmots can act as a reservoir for the bacteria across the globe. Transmission between these animals and to human hosts generally occurs via the bite of Y. pestis infected male and female fleas. The primary flea vector is the oriental rat flea (Xenopsylla cheopis). Transmission can also occur by handling or skinning infected animals, or by inhaling infected droplets from the cough of a pneumonic plague infected individual 1 2. Media reports suggest that the first fatal human case in the Qinghai outbreak may have resulted from handling a dead Y. pestis infected dog which had eaten an infected marmot.
plague-cycles1-300x209 Quarantine: Pneumonic Plague Outbreak in China

Plague Cycles (Neal R. Chamberlain 2003)

There are three types of disease caused by infection with the Y. pestis bacterium: bubonic, septicaemic and pneumonic plague. Bubonic and septicaemic plagues can have high mortality rates (up to 60%) without treatment; pneumonic plague has 100% mortality in the absence of treatment 3. Bubonic plague is characterized by high fever and infection of the lymph nodes; here bacteria multiply to result in characteristic enlarged, tender and necrotic glands. Septicaemic plague is rarer than bubonic plague, and occurs when the bacteria circulate in the blood rather than localizing in the lymph nodes. Bubonic and septicemic plagues can only be transmitted after direct contact with infected fluid from the lymph nodes (bubonic) or infected blood (septicaemic), so person-to-person transmission generally does not occur. Pneumonic plague is characterized by infiltration of bacteria to the lung, followed by pneumonia with coughing and dispersal of respiratory droplets in the air. Person-to-person transmission can occur via airborne bacteria after close physical contact with pneumonic plague sufferers 3-5.

Upon hearing of the Chinese plague outbreak, I was reminded of my medieval history lessons at school. I wondered about the relationship between the current outbreak and the black death plague of the middle ages. Modern day plague outbreaks do not even begin to approach the scope of those of the 14th century black death, which is widely considered to have resulted from a bubonic plague pandemic caused by infection with Y. pestis. The black death affected people in both urban and rural areas without discrimination. Populations were decimated to the extent that 25 million deaths are estimated to have occurred, wiping out a third of Europes population. If indeed Y. pestis was the primary pathogen, the 14th century pandemic most likely included sufferers with all 3 types of plague. It has also been suggested that The Justinian plague of 600AD may have resulted from Y. pestis infection 4.
world-distribution-of-plague1 Quarantine: Pneumonic Plague Outbreak in China

(CDC; Reviewed 2005)

In recent years, African countries have accounted for around 90% of plague cases reported to the WHO, but outbreaks have occurred across the globe. One recent plague outbreak occurred in Northwestern Uganda in 2006. Here 127 plague cases were confirmed, 102 patients had documented symptoms; 90 had bubonic, and 12 had pneumonic plague. There were 11 pneumonic plague deaths during this outbreak, but overall mortality rates were much lower at 22%. During this Ugandan outbreak there were reports of dead black rats (Rattus rattus). Half of the recovered dead rats were infected with Y. pestis, live rats caught within infected villages had an average of 2 fleas. The flea bite transmits the bacteria from the rodent to the human host, so multiple fleas on infected rodents increase the risk of transmission 6. Small numbers (2-17) of plague cases are reported annually in the USA 7 and recent outbreaks of plague have also occurred in Algeria (2002), India (2002) and the Democratic Republic of Congo (DRC) 8. The ongoing humanitarian crisis in DRC has meant that all efforts at controlling plague have stopped; since 2001, around 1000 suspected plague cases have been reported annually from DRC 9.

Y. pestis is considered a high risk pathogen and a potential biological weapon. The bacteria can be transmitted via aerosol with 100% mortality rates in humans in the absence of treatment (e.g. pneumonic plague). In addition, as symptoms of pneumonic plague may not be evident for up to 6 days after infection with Y. pestis, this could possibly allow dispersal of the pathogen to a large population before antibiotic intervention occurs 5. However, the bacteria remain infectious as airborne pathogens for less than one hour and can only spread within a few metres from the pneumonic plague sufferer; these factors may limit the potential for Y. pestis transmission to large populations 3-5.

While all this plague outbreak talk may seem quite frightening, outbreaks of plague are extremely rare, even in the least developed countries of the world. Where outbreaks do occur, disease containment is usually swift and certain. Plague deaths are rare and antibiotics can effectively treat the disease, especially when its identified early. Biomedical research is also underway globally to further study the genetic and virulence characteristics of Y. pestis, as well as to develop fast acting vaccines against the bacteria. For your own sanity please dont have nightmares about modern day plague scenarios! Despite existing reservoirs for the Y. pestis bacteria in some wild rodent populations, the risk of plague epidemics or pandemics is miniscule.

1. CDC. Plague Fact Sheet. 2005; http://www.cdc.gov/ncidod/dvbid/plague/resources/plagueFactSheet.pdf

2. CDC. Protect yourself from plague. http://www.cdc.gov/ncidod/dvbid/plague/resources/plaguebrochure.pdf

3. Butler T. Plague into the 21st century. Clin Infect Dis 2009; 49 (5) 736-42 http://www.journals.uchicago.edu/doi/pdf/10.1086/604718

4. Crawford D. Deadly Companions: How Microbes Shaped Our History. 2007; Chapter 4 85-106 http://www.amazon.co.uk/gp/reader/0192807196/ref=sib_dp_pt#reader-link

5. CDC. Frequently asked questions about the plague. 2005; http://www.bt.cdc.gov/agent/plague/faq.asp

6. CDC. Bubonic and pneumonic plague - Uganda, 2006. MMWR Morb Mortal Wkly Rep 2009; 58 (28) 778-81 http://www.cdc.gov/mmwr/preview/mmwrhtml/mm5828a3.htm

7. CDC. Notifiable Diseases/Deaths in Selected Cities Weekly Information. MMWR Morb Mortal Wkly Rep 2009; 58 (29) 808-819 http://www.cdc.gov/mmwr/preview/mmwrhtml/mm5829md.htm

8. WHO. Global Alert and Response (GAR): Plague. http://www.who.int/csr/don/archive/disease/plague/en/index.html

9. CDC. Plague: Enhancing country readiness. 2009; http://www.who.int/csr/disease/plague/readiness2005_1_11/en/index.html

More on these topics:

Airborne, Algeria, Bacteria, Bio-weapon, Black death, Black rat, Bubonic plague, China, Democratic Republic of Congo, Flea, India, Justinian plague, Plague, Pneumonic plague, Qinghai Province, Quarantine, Rattus rattus, Rodent, Septicaemic plague, Uganda, USA, Xenopsylla cheopis, Yersinia pestis, Ziketan



http://thefastertimes.com/globalpandemics/2009/08/09/quarantine-pneumonic-plague-outbreak-in-china/

Ed Jewett
08-09-2009, 05:17 PM
See also:


http://www.new-fields.com/ISFC/brochure.pdf

a six-page brochure for the International Swine Flu Conference in Washington on August 19-21, 2009
Hyatt Regency Washington on Capitol Hill
400 New Jersey Avenue, NW, Washington, D.C., USA 20001


related article:
http://www.globalresearch.ca/index.php?context=va&aid=14705

Ed Jewett
08-10-2009, 02:25 AM
Biological Warfare and the National Security State
A Chronology

by Tom Burghardt

http://www.globalresearch.ca/coverStoryPictures/14708.jpg. Global Research (http://www.globalresearch.ca/), August 9, 2009
Antifascist Calling... (http://antifascist-calling.blogspot.com/)

http://www.globalresearch.ca/site_images/emailfriend.gif Email this article to a friend (http://javascript%3Cb%3E%3C/b%3E:sendarticle%28%27sendEmailLink%27,%20%27Biolo gical%20Warfare%20and%20the%20National%20Security% 20State%27%29;)
http://www.globalresearch.ca/site_images/printfriendly.gif Print this article (http://javascript%3Cb%3E%3C/b%3E:printarticle%2814708%29;)



http://cdn.stumble-upon.com/images/32x32_su_round.gif (http://www.stumbleupon.com/submit?url=http%3A%2F%2Fwww.globalresearch.ca%2Fin dex.php%3Fcontext%3Dva%26aid%3D14708)
The history of bioweapons research in the United States is a history of illicit--and illegal--human experiments.
From the Cold War to the War on Terror, successive American administrations have turned a blind eye on dubious research rightly characterized as having "a little of the Buchenwald touch."
While the phrase may have come from the files of the Atomic Energy Commission as Pulitzer prize-winning journalist Eileen Welsome revealed in her 1999 book, The Plutonium Files, an investigation into secret American medical experiments at the dawn of the nuclear age, it is as relevant today as the United States pours billions of dollars into work on some of the most dangerous pathogens known to exist in nature.
That Cold War securocrats were more than a little concerned with a comparison to unethical Nazi experiments is hardly surprising. After all, with the defeat of the Axis powers came the triumphalist myth-making that America had fought a "good war" and had liberated humanity from the scourge of fascist barbarism.
Never mind that many of America's leading corporations, from General Motors to IBM and from Standard Oil to Chase National Bank, were sympathizers and active collaborators with the Third Reich prior to and even during World War II, as documented by investigative journalists Charles Higham in Trading With The Enemy, and Edwin Black in IBM and the Holocaust. Like much else in American history, these were dirty little secrets best left alone.
Soon enough however, these erstwhile democrats would come to view themselves as mandarins of a new, expanding American Empire for whom everything was permitted. In this context, the recruitment of top German and Japanese scientists who had conducted grisly "medical" experiments whilst waging biological war against China and the Soviet Union would be free of any moralizing or political wavering.
As the Cold War grew hotter and hotter, America's political leadership viewed "former" Nazis and the architects of Japan's Imperial project not as war criminals but allies in a new undertaking: the global roll-back of socialism and the destruction of the Soviet Union by any means necessary.
This tradition is alive and well in 21st century America. With the September 11, 2001 terrorist attacks and subsequent anthrax mailings as a pretext for an aggressive militarist posture, the national security state is ramping-up research for the production of genetically-modified organisms for deployment as new, frightening weapons of war.
According to congressional testimony (http://archives.energycommerce.house.gov/cmte_mtgs/110-oi-hrg.100407.Pearson-testimony.pdf) by Dr. Alan M. Pearson, Director of the Biological and Chemical Weapons Control Program at the Washington D.C.-based Center for Arms Control and Non-Proliferation (http://www.armscontrolcenter.org/), with very little in the way of effective oversight or accountability, tens of billions of dollars "have been appropriated for bioweapons-related research and development activities." Pearson reveals that approximately $1.7 billion "has been appropriated for the construction on new high containment facilities for bioweapons-related research."
By high containment facilities I mean facilities that are designed for work with agents that may cause serious or potentially lethal disease through exposure to aerosols (called Biosafety Level 3 or BSL-3 facilities) and facilities that are designed for work with agents that pose a "high individual risk of life-threatening disease, which may be transmitted via the aerosol route and for which there is no available vaccine or therapy" (called Biosafety Level 4 or BSL-4 facilities).
Prior to 2002, there were three significant BSL-4 facilities in the United States. Today twelve are in operation, under construction, or in the planning stage. When completed, there will be in excess of 150,000 square feet of BSL-4 laboratory space (as much space as three football fields). The number of BSL-3 labs is also clearly growing, but ascertaining the amount of growth is difficult in the absence of accurate baseline information. There are at least 600 such facilities in the US. (Alan M. Pearson, Testimony, "Germs, Viruses, and Secrets: The Silent Proliferation of Bio-Laboratories in the United States," House Energy and Commerce Committee, Subcommittee on Oversight and Investigations, October 2007)
Chillingly, one consequence of this metastatic growth "is that the very labs designed to protect against bioweapons may become a source for them." As the 2001 anthrax attacks amply demonstrated, the threat posed by a biological weapons' incident may be closer to home than any of us care to think. Pearson writes, "Nor should we ignore the possibility that a US biologist may become disgruntled or turn rogue while working in one of these labs."
According to Edward Hammond, the Director of the now-defunct Sunshine Project (http://www.sunshine-project.org/), while "biological arms control is currently in ... its worst crisis since the signing of the Bioweapons Convention (BWC) in 1972," the American Bioweapons-Industrial Complex has "embarked on the exploitation of biotechnology for weapons development." Indeed, Hammond relates that active programs utilizing genetic engineering techniques have "been employed in offensive biowarfare programs in order to make biowarfare agents more effective."
But increases in state subsidies for such work have generated new risks to the public. A recent Government Accountability Office (GAO) report (http://www.gao.gov/new.items/d09851.pdf) faulted the Centers for Disease Control and Prevention (CDC) for lax security at three of the nation's five BSL-4 labs currently in operation that "handle the world's most dangerous agents and toxins that cause incurable and deadly diseases." Agents such as Ebola, Marburg and smallpox are routinely studied at these facilities. And yet, as GAO auditors found,
Select agent regulations do not mandate that specific perimeter security controls be present at BSL-4 labs, resulting in a significant difference in perimeter security between the nation's five labs. According to the regulations, each lab must implement a security plan that is sufficient to safeguard select agents against unauthorized access, theft, loss, or release. However, there are no specific perimeter security controls that must be in place at every BSL-4 lab. While three labs had all or nearly all of the key security controls we assessed, our September 2008 report demonstrated that two labs had a significant lack of these controls. (Government Accountability Office, Biosafety Laboratories: BSL-4 Laboratories Improved Perimeter Security Despite Limited Action by CDC, GAO-09-851, July 2009)
As Global Security Newswire revealed (http://gsn.nti.org/gsn/nw_20090618_8179.php) in June, a "recently completed inventory at a major U.S. Army biodefense facility found nearly 10,000 more vials of potentially lethal pathogens than were known to be stored at the site."
The 9,220 samples--which included the bacterial agents that cause plague, anthrax and tularemia; Venezuelan, Eastern and Western equine encephalitis viruses; Rift valley fever virus; Junin virus; Ebola virus; and botulinum neurotoxins--were found during a four-month inventory at the U.S. Army Medical Research Institute of Infectious Diseases at Fort Detrick, Md., according to Col. Mark Kortepeter, the center's deputy commander. (Martin Matishak, "Thousands of Uncounted Disease Samples Found at Army Biodefense Lab," Global Security Newswire, June 18, 2009)
The GSN report states that while "half of the newfound material was destroyed after being recorded," inventory control officer Sam Edwin told reporters that "the other half was deemed worthy for further scientific use, cataloged, and stored in the center's containment freezers."
More pertinently, what happens when the state itself turns "rogue" and under cover of national security and the endless "war on terror" creates the "acute risk" in the form of out-of-control laboratories "designed to protect against bioweapons" that instead, have "become a source for them"?
Bioweapons and National Security: A Chronology
Source Notes: This chronology has drawn from dozens of books, articles and declassified government documents in its preparation. Notable in this regard is Michael Christopher Carroll's Lab 257: The Disturbing Story of the Government's Secret Germ Laboratory; Linda Hunt, Secret Agenda; Bob Coen and Eric Nadler, Dead Silence: Fear and Terror on the Anthrax Trail; the National Security Archive's documentary history of U.S. Biological Warfare programs (http://www.gwu.edu/%7Ensarchiv/NSAEBB/NSAEBB58/) and The Sunshine Project (http://www.sunshine-project.org/).
* August 1945: Operation Paperclip, an Office of Strategic Services (OSS) program to import top Nazi scientists into the United States. Linda Hunt relates in her book, Secret Agenda, that Reich Health Leader (Reichsgesundheitsfhrer) Dr. Kurt Blome, was saved from the gallows due to American intervention. Blome admitted he had worked on Nazi bacteriological warfare projects and had experimented on concentration camp prisoners with bubonic plague and sarin gas at Auschwitz. After his acquittal at the 1947 Nuremberg Doctors' Trial, Blome was recruited by the U.S. Army Chemical Corps and advised the Pentagon on biological warfare. Walter Paul Emil Schreiber, a Wehrmacht general who assigned doctors to experiment on concentration camp prisoners and disbursed state funds for such experiments was another Paperclip recruit; in 1951, Schreiber went to work for the U.S. Air Force School of Medicine. Hubertus Strughold, the so-called "father of space medicine" discussed--and carried out--experiments on Dachau inmates who were tortured and killed; Strughold worked for the U.S. Air Force. Erich Traub, a rabid Nazi and the former chief of Heinrich Himmler's Insel Riems, the Nazi state's secret biological warfare research facility defects to the United States. Traub was brought to the U.S. by Paperclip operatives and worked at the Naval Medical Research Institute and gave "operational advice" to the CIA and the biowarriors at Ft. Detrick.
* September 1945: General Shiro Ishii's Unit 731, a secret research group that organized Japan's chemical and biological warfare programs is granted "amnesty" by Supreme Allied Commander in the Pacific, General Douglas MacArthur in exchange for providing America with their voluminous files on biological warfare. All mention of Unit 731 is expunged from the record of The Tokyo War Crimes Tribunal. During the war, Unit 731 conducted grisly experiments, including the vivisection of live prisoners, and carried out germ attacks on Chinese civilians and prisoners of war. According to researcher Sheldon H. Harris in Factories of Death: Japanese Biological Warfare 1932-45 and the American Cover-Up, Unit 731 scientists performed tests on prisoners with plague, cholera, smallpox, botulism and other infectious diseases. Their work led to the development of what was called a defoliation bacilli bomb and a flea bomb used by the Imperial Army to spread bubonic plague across unoccupied areas of China. The deployment of these lethal munitions provided the Imperial Army with the ability to launch devastating biological attacks, infecting agriculture, reservoirs, wells and populated areas with anthrax, plague-infected fleas, typhoid, dysentery and cholera. Rather than being prosecuted as war criminals, Unit 731 alumni became top bioweapons researchers. Ishii himself became an adviser at USAMRIID at Ft. Detrick.
1950: A U.S. Navy ship equipped with spray devices supplied by Ft. Detrick, sprayed serratia marcescens across the San Francisco Bay Area while the ship plied Bay waters. Supposedly a non-pathogenic microorganism, twelve mostly elderly victims die.
* Early 1950s: Army biological weapons research begins at the Plum Island Animal Disease Center (PIADC). Vials of anthrax are transferred from Ft. Detrick to Plum Island. This information is contained in a now declassified report, "Biological Warfare Operations," Research and Development Annual Technical Progress Report, Department of the Army, 1951.
* 1951: Racist experiments are carried out. U.S. Army researchers deliberately expose African-Americans to the fungus Aspergillus fumigatus to discern whether they are more susceptible to infections caused by such organisms than white Europeans. Also in 1951, black workers at the Norfolk Supply Center in Virginia were exposed to crates contaminated with A. fumigatus spores.
* 1952: According to 1977 hearings (http://www.druglibrary.org/schaffer/history/e1950/mkultra/index.htm) by the Senate Select Committee on Intelligence and the Subcommittee on Health and Scientific Research into Project MKULTRA, we discover the following: "Under an agreement reached with the Army in 1952, the Special Operations Division (SOD) at Fort Detrick was to assist CIA in developing, testing, and maintaining biological agents and delivery systems. By this agreement, CIA acquired the knowledge, skill, and facilities of the Army to develop biological weapons suited for CIA use."
* 1953: Frank Olson, a chemist with the Army's top secret Special Operations Division at Ft. Detrick was involved with biological weapons research and was tasked to the CIA for work on MKULTRA. In 1953, as Deputy Acting Head of Special Operations for the CIA, Olson is a close associate of psychiatrist William Sargant who was investigating the use of psychoactive drugs as an interrogation tool at Britain's Biological Warfare Centre at Porton Down. After being dosed with LSD without his knowledge by Dr. Sidney Gottlieb, the Agency's liaison to Ft. Detrick, Olson undergoes a severe psychological crisis. The scientist begins questioning the ethics of designing biological organisms as weapons of war. This does not sit well with his Agency and Army superiors. On November 24, 1953, Olson and a CIA minder, Robert Lashbrook, check into New York's Staler Hotel. He never checked out. According to Lashbrook, Olson had thrown himself through the closed shade and window, plunging 170 feet to his death. But because of his knowledge of CIA "terminal experiments" and other horrors conducted under MKULTRA, the Olson family believes the researcher was murdered. When Olson's son Eric has his father's body exhumed in 1994, the forensic scientist in charge of the examination determines that Olson had suffered blunt force trauma to the head prior to his fall through the window; the evidence is called "rankly and starkly suggestive of homicide." Norman G. Cournoyer, one of Olson's closet friends at Ft. Detrick also believes the scientist was murdered. When asked by the Baltimore Sun (http://www.sfgate.com/cgi-bin/article.cgi?file=/c/a/2004/09/12/MNG468MM8N1.DTL) in 2004 why Olson was killed, Cournoyer said, "To shut him up. ... He wasn't sure we should be in germ warfare, at the end."
* 1955: Following a CIA biowarfare test in Tampa Bay, Florida, the area experiences a sharp rise in cases of Whooping Cough, including 12 deaths. The Agency had released bacteria it had obtained from the U.S. Army's Chemical and Biological Warfare Center at the Dugway Proving Grounds.
* 1956-1958: More racist experiments. The U.S. Army conducted live field tests on poor African-American communities in Savannah, Georgia and Avon Park, Florida. Mosquitoes were released into neighborhoods at ground level by "researchers" or by helicopter; residents were swarmed by the pest; many developed unknown illnesses and some even died. After the tests, Army personnel posing as health workers photographed and tested the victims, then disappeared. While specific details of the experiments remain classified, it has been theorized that a strain of Yellow Fever was used to test its efficacy as a bioweapon.
* 1962: A declassified CIA document (http://www.gwu.edu/%7Ensarchiv/NSAEBB/NSAEBB222/top06.pdf) obtained by the National Security Archive relates the following: "In November 1962 Mr. [redacted] advised Mr. Lyman Kirkpatrick that he had, at one time, been directed by Mr. Richard Bissell to assume responsibility for a project involving the assassination of Patrice Lumumba, then Premier, Republic of Congo. According to Mr. [redacted] poison was to have been the vehicle as he made reference to having been instructed to see Dr. Sidney Gottlieb in order to procure the appropriate vehicle." Gottlieb was the chief scientific adviser for the CIA's MKULTRA program.
* June 1966: The U.S. Army's Special Operations Division dispenses Bacillus subtilis var niger throughout the New York City subway system. More than a million people were exposed when Army operatives dropped light bulbs filled with the bacteria onto ventilation grates.
* December, 1967: The New York Times reports, "Fatal Virus Found in Wild Ducks on L.I." A virus never seen before in the Western hemisphere, began with ducks in Long Island at a site opposite Plum Island; the virus devastates the area's duck industry and by 1975 has spread across the entire continent.
* 1971: The U.S. Department of Agriculture proclaims that "Plum Island is considered the safest in the world on virus diseases." USDA's proof? "There has never been a disease outbreak among the susceptible animals maintained outside the laboratory since it was established."
* 1975: PIADC begins feeding live viruses to "hard ticks," including the Lone Star tick (never seen outside Texas prior to 1975). The Lone Star tick is a carrier of the Borelia burgdorferi (Bb) bacteria, the causal agent of Lyme Disease. The first cases of the illness are reported in Connecticut, directly across from the facility. Current epidemiological data conclusively demonstrate that the epicenter of all U.S. Lyme Disease cases is Plum Island. It is theorized that deer bitten by infected ticks swam across the narrow waterway separating the island from the mainland.
* September 1978: A PIADC news release relays the following: "Foot and Mouth Disease has been diagnosed in cattle in a pre-experimental animal holding facility at the Plum Island Animal Disease Center." A documented outbreak has occurred.
* 1979: An internal investigation of the FMD incident reveals massive, widespread failures in the containment systems at PIADC. A USDA Committee report recommends that "Lab 101 not be considered as a safe facility in which to do work on exotic disease agents until corrective action is accomplished."
* 1979: Despite containment failures and poor practices, USAMRIID undertakes the investigation of the deadly Zagazig 501 strain of Rift Valley Fever at PIADC. Producing symptoms similar to aerosolized hemorrhagic fevers such as Marburg and Ebola virus, the Army inoculates sheep that should have been destroyed as a result of the FMD outbreak with an experimental Rift Valley Fever vaccine. The experiments are conducted outdoors, in violation of the lab's primary directive prohibiting such work. During a 1977 Rift Valley outbreak in Egypt, some 200,000 people are infected and 700 others die excruciating deaths. A survey of blood serum taken before 1977 proved that the virus was not present in Egypt prior to the epidemic. By 2000, rampant outbreaks of the disease have occurred in Saudi Arabia and Yemen with the virus poised to unfurl its tentacles into Europe.
* 1982: A Federal review begun after the FMD outbreak concludes: "We believe there is a potentially dangerous situation and that without an immediate massive effort to correct deficiencies, a severe accident could result... [L]ack of preventive maintenance, [and] pressures by management to expedite programs have resulted in compromising safety."
* 1983: Six PIADC workers test positive for African Swine Fever virus. The workers are not notified of the test results which are conducted clandestinely during routine annual physical exams.
* 1991: USDA privatizes PIADC. A New Jersey firm, Burns & Roe Services Corporation low bids other competitors and is awarded the contract. In cost-cutting moves, the contractor scales back on safety and security measures in place for decades.
* June 1991: An underground cable supplying Lab 257 shorts out but is not replaced since there is no money left in the budget.
* August 1991: Hurricane Bob, a category 3 storm similar to Hurricane Katrina, slams into Plum Island, knocking down overhead power lines that connect Lab 257. The underground cable which was Lab 257's primary power source has not been repaired. Freezers containing virus samples defrost, air seals on lab doors are breached and animal holding room vents fail. PIADC's "fail safe" mechanism of "air dampers" to seal off the facility also fail. Melted virus samples mix with infected animal waste on lab floors as swarms of mosquitoes fill the facility.
* September 1991: The USDA denies that any system failures occurred during the hurricane. Whistleblowing workers in Lab 257 at the time of the blackout are fired in further cost-cutting moves and several subsequently develop mysterious undiagnosed diseases.
* 1992: The Occupational Safety and Health Administration (OSHA) and the Environmental Protection Agency (EPA) cite PIADC with hundreds of safety violations. When OSHA returned five years later, none of the violations have been corrected and discover 124 new violations.
* July 1992: Although USDA officially denies that PIADC conducts biological warfare research, fourteen officials from the Joint Chiefs of Staff and the Pentagon visit Plum Island. Internal documents reveal that that the visit was "to meet with [Plum Island] staff regarding biological warfare." According to Carroll, "the visitors were part of the Arms Control and Disarmament Agency reviewing the dual-use capabilities of the facility."
* Spring 1995: Lab 257 is closed. Although scheduled to be fully decontaminated and demolished in 1996 Carroll reports: "Lab 257 still stands today, rotting from weathered decay, harboring who knows what deep within."
* August 1999: The first four human cases of West Vile virus, a mosquito-borne pathogen never diagnosed in North America are diagnosed on Long Island. Horse farms within a five-mile radius of one another, directly opposite Plum Island, report horses dying following violent seizures. An investigation reveals that 25% of the horses in this small, localized area test positive for West Nile. The outbreak begins in August 1999 when birds, including half the exotic bird species in the Bronx Zoo begin dying mysteriously. The virus has an affinity for birds and the vector is soon identified as the mosquito. In 1999, the disease was confined to the New York City area, however by 2002, the Centers for Disease Control reports all but 6 of the lower 48 states reported West Nile virus in birds, mosquitos, animals or human populations. CDC estimates that some 200,000 people are infected nationally. During the initial outbreak in 1999, veterinary pathologist Tracey McNamara suspected a casual relationship between the bird die-offs and the human cases; CDC rebuffs her concerns. Through her persistent efforts, it is determined that the virus was indeed West Nile, a pathogen that had never been seen in North America. The CDC announces that West Nile virus was in the nation's blood supply when transplant patients who had no prior exposure to the pathogen develop the disease. The USDA's response? Deny, deny, deny? However, Jim House, a former PIADC scientist, believes that West Nile samples existed prior to 1999 on Plum Island. He told Carroll, "There were samples there, and it wasn't answered clearly to the public. They didn't honestly tell how many samples they had and that's when people started to get upset. When Carroll filed a Freedom of Information Act request for a catalog of germs held in the Plum Island virus library, he was turned down on grounds of "national security."
* September 1999: The New York Times reports that due to "the growing threat of biological terrorism" against America's food supply, USDA "is seeking money to turn the Plum Island Animal Disease Center ... into a top security laboratory where some of the most dangerous diseases known to man or beast can be studied."
* 1999: A Cold War-era document is declassified proving that in the early 1950s USAMRIID shipped twelve vials of weaponized anthrax (enough to kill one million people) to PIADC. In 1993 Newsday revealed that previously unclassified documents demonstrated Pentagon plans to disrupt the Soviet economy by spreading diseases to kill pigs, cattle and horses.
* 1999: Plans to "upgrade" PIADC by building a BSL-4 lab are killed when Congress pulls funding after a public outcry.
* September 2001: After the anthrax attacks, despite USDA denials that anthrax was ever present on the island, FBI investigators include the following questions in their polygraph examination of scientists under investigation: "Have you ever been to Plum Island?" "Do you know anyone who works at Plum Island?" "What do they do there?"
* December 2002: The New York Times reports "a three-hour power failure at the Plum Island Animal Disease Center last weekend renewed concerns about the safety of the high-security government laboratory." According to the Times, "the loss of power and failure of all three backup generators raised fears for the first time that the containment of infectious pathogens could have been seriously compromised at the laboratory."
* June 2003: President George W. Bush transfers control of PIADC to the Department of Homeland Security. The airspace over the island is unrestricted and the gates leading to Lab 101 remain open and unguarded.
* May 2004: In a sign that work on Plum Island is being shifted to "other sites," including those run by private contractors, DHS announces an $18 million grant to study Rift Valley fever, avian influenza and brucellosis.
* August 2004: DHS confirmed that an FMD outbreak "had spread briefly" in "two previously undisclosed incidents earlier this summer," The New York Times reports. A DHS spokesperson said the virus remained "within the laboratory's sealed biocontainment area" and that there "had be no risk" to human or animals. An investigation into the cause "was continuing."
* 2004: At the Medical University of Ohio, a researcher is infected with Valley Fever at the center's BSL-3 facility; Valley Fever is a biological weapons agent.
* February 2005: University of Iowa researchers conduct unauthorized genetic engineering experiments with the select agent Tularemia (rabbit fever). The Sunshine Project reports that researchers mixed genes from Tularemia species and introduced antibiotic resistant characteristics into the samples.
* March 2005: When a containment facility fails, workers at the University of North Carolina at Chapel Hill are exposed to tuberculosis when the BSL-3 "fail-safe" systems malfunction; a blower pushes contaminated air out of the work cabinet, infecting the workroom. The facility had been inspected one month prior to the accident by U.S. Army.
* Summer 2005: At the same Ohio facility a serious accident occurs when workers are infected with an aerosol of Valley Fever.
* October-November 2005: Dozens of samples thought to be harmless are received by the University of California at Berkeley. In fact, they are samples of Rocky Mountain Spotted Fever, a BSL-3 bioweapons agent due to its transmission as an aerosol. The samples are handled without adequate safety precautions; however, the community is never notified of the incident.
* August 2005: The whistleblowing watchdog group Tri-Valley Cares (http://trivalleycares.presstools.org/node/33429) obtains documents in May 2009 proving that the Lawrence Livermore National Laboratory had conducted "restricted experiments" with "select biological agents" at the facility. In 2005, LLNL "inadvertently" released anthrax at the lab in another incident that lab officials attempted to cover-up; five individuals were infected with the deadly pathogen.
* April 2006: Three Texas A&M "biodefense" researchers are infected with Q Fever, a biological weapons agent. Rather than reporting the incident to the CDC as required by law, Texas A&M officials cover-up the accident.
* August 2006: DHS announces that PIADC is "not on the rebuilding list" and a new site to study infectious diseases is being considered.
* January 2009: DHS announces that the new National Bio and Agro-Defense Facility will be built in Manhattan, Kansas.
* July 2009: Government Accountability Office investigators charge (http://www.gao.gov/new.items/d09747.pdf) that DHS relied on "a rushed, flawed study" to locate the $700 million research facility for highly infectious pathogens "in a tornado-prone section of Kansas." Among other concerns, the GAO cites DHS's "flawed and outdated methodology" in its criticism. Those concerns are: "the ability of DHS and the federal government in general to safely operate a biosafety facility such as the proposed NBAF; the potential for a pathogenic release through accidents, natural phenomena, and terrorist actions; our May 2008 testimony that concluded that DHS had not conducted or commissioned a study to determine whether FMD research could be conducted safely on the U.S. mainland; natural phenomena such as tornadoes, earthquakes, and hurricanes that could cause catastrophic damage to the NBAF and result in the release of a pathogen; the possibility that an infected mosquito vector could escape, allowing a pathogen such as Rift Valley Fever virus to become permanently established in the United States; the economic effects of a release or a perceived release on the local, state, and national livestock industry."
Tom Burghardt is a researcher and activist based in the San Francisco Bay Area. In addition to publishing in Covert Action Quarterly and Global Research (http://globalresearch.ca/), his articles can be read on Dissident Voice (http://www.dissidentvoice.org/), The Intelligence Daily (http://www.inteldaily.com/), Pacific Free Press (http://www.pacificfreepress.com/) and the whistleblowing website Wikileaks (http://www.wikileaks.org/). He is the editor of Police State America: U.S. Military "Civil Disturbance" Planning, distributed by AK Press (http://www.akpress.org/2002/items/policestateamerica).



http://www.globalresearch.ca/index.php?context=va&aid=14708

Jack White
08-10-2009, 02:31 AM
http://www.legitgov.org/baxter_vaccine_oddities.html

Ed Jewett
08-10-2009, 04:02 AM
FEMA Awards Contract to PaTH Joint Venture of DynCorp International, Dewberry and Parsons

http://www.earthtimes.org/newsimage/Bus_20090710160728_19.jpg
Posted : Fri, 10 Jul 2009 14:06:29 GMT Author : DynCorp International Category : Press Release (http://www.earthtimes.org/articles/pg/0.html) News Alerts by Email ( click here (http://www.earthtimes.org/member/) ) Press Release News | Home (http://www.earthtimes.org/)

http://www.earthtimes.org/eimage/smallrss.gif (http://feeds.earthtimes.org/earthtimes/PressRelease) http://www.earthtimes.org/eimage/print.gif (http://www.earthtimes.org/articles/show/fema-awards-contract-to-path,888189.shtml#) http://www.earthtimes.org/eimage/email.gif (http://www.earthtimes.org/articles/show/fema-awards-contract-to-path,888189.shtml#) http://www.earthtimes.org/eimage/mess.gif (http://www.earthtimes.org/articles/show/fema-awards-contract-to-path,888189.shtml#hys)


FALLS CHURCH, Va. - (Business Wire) The Federal Emergency Management Agency (FEMA) has awarded a contract to Partnership for Temporary Housing, LLC (PaTH) to provide temporary housing and support for shelter operations for disaster victims. The indefinite delivery/indefinite quantity Individual Assistance-Technical Assistance Contract III (IA-TAC III), has a potential value of $375 million over the one-year base period and four one-year option periods. PaTH is a limited liability corporation formed by DynCorp International LLC, Dewberry, and Parsons Corporation. PaTH provides responsive, cost-effective temporary housing services and mass care solutions to disaster victims on behalf of the Department of Homeland Securitys FEMA. In 2008, PaTH assisted flood victims in Iowa with the provision of temporary shelter, under its IA-TAC II contract.

Under the IA-TAC III contract, the PaTH joint venture is responsible for work in the western continental U.S., as well as Alaska, Hawaii, Guam and American Samoa. The primary work to be performed under task orders is expected to include the provision of temporary housing and support to shelter operations in the assigned sector.

About DynCorp International
DynCorp International (NYSE-CP) is a provider of specialized mission-critical services to civilian and military government agencies worldwide, and operates major programs in law enforcement training and support, security services, base operations, aviation services, contingency operations, and logistics support. DynCorp International is headquartered in Falls Church, Va. For more information, visit www.dyn-intl.com (http://cts.businesswire.com/ct/CT?id=smartlink&url=http%3A%2F%2Fwww.dyn-intl.com&esheet=6004327&lan=en_US&anchor=www.dyn-intl.com&index=1).

About Dewberry
For a half-century, Dewberry has been a leader in the planning, design, and program management professions. We work in partnership with public- and private-sector clients locally, regionally, and nationally. Our multi-disciplinary staff includes engineers, architects, planners, surveyors, environmental scientists, and many specialized experts. Dewberry offers clients an integrated service approach with a commitment to value and performance. Established in 1956, Dewberry is headquartered in Fairfax, Va. For more information, visit www.dewberry.com (http://cts.businesswire.com/ct/CT?id=smartlink&url=http%3A%2F%2Fwww.dewberry.com%2F&esheet=6004327&lan=en_US&anchor=www.dewberry.com&index=2).

About Parsons
Parsons is a leader in many diverse markets such as infrastructure, transportation, water, telecommunications, aviation, commercial, environmental, industrial manufacturing, education, healthcare, life sciences and homeland security. Parsons provides technical and management solutions to federal, regional and local government agencies as well as private industries worldwide. Parsons is headquartered in Pasadena, Ca. For more information, visit www.parsons.com (http://cts.businesswire.com/ct/CT?id=smartlink&url=http%3A%2F%2Fwww.parsons.com&esheet=6004327&lan=en_US&anchor=www.parsons.com&index=3).

DynCorp International
Douglas Ebner, 817-224-7822


http://www.earthtimes.org/articles/show/fema-awards-contract-to-path,888189.shtml

Magda Hassan
08-10-2009, 04:25 AM
Dynacorp. A fully integrated business model.

Jan Klimkowski
08-10-2009, 07:13 PM
For the true story of Frank Olson, and the strong possibility that he was, in part, murdered because he was about to disclose details of American use of germ warfare in the Korean War, see the Code Name Artichoke video, featuring his son, here:

http://www.deeppoliticsforum.com/video_playlist.html

Kudos to the indefatigable Magda. :five:

Ed Jewett
08-15-2009, 08:21 AM
By MARIA CHENG, AP Medical Writer Fri Aug 14, 9:36 am

Polio surge in Nigeria after vaccine virus mutates



LONDON Polio, the dreaded paralyzing disease stamped out in the industrialized world, is spreading in Nigeria. And health officials say in some cases, it's caused by the vaccine used to fight it.

In July, the World Health Organization issued a warning that this vaccine-spread virus might extend beyond Africa. So far, 124 Nigerian children have been paralyzed this year about twice those afflicted in 2008.

The polio problem is just the latest challenge to global health authorities trying to convince wary citizens that vaccines can save them from dreaded disease. For years, myths have abounded about vaccines that they were the Western world's plan to sterilize Africans or give them AIDS. The sad polio reality fuels misguided fears and underscores the challenges authorities face using a flawed vaccine.

Nigeria and most other poor nations use an oral polio vaccine because it's cheaper, easier, and protects entire communities.

But it is made from a live polio virus albeit weakened which carries a small risk of causing polio for every million or so doses given. In even rarer instances, the virus in the vaccine can mutate into a deadlier version that ignites new outbreaks.

The vaccine used in the United States and other Western nations is given in shots, which use a killed virus that cannot cause polio.

So when WHO officials discovered a polio outbreak in Nigeria was sparked by the polio vaccine itself, they assumed it would be easier to stop than a natural "wild" virus.

They were wrong.

In 2007, health experts reported that amid Nigeria's ongoing outbreak of wild polio viruses, 69 children had also been paralyzed in a new outbreak caused by the mutation of a vaccine's virus.

Back then, WHO said the vaccine-linked outbreak would be swiftly overcome yet two years later, cases continue to mount. They have since identified polio cases linked to the vaccine dating back as far as 2005.

It is a worrying development for officials who hope to end polio epidemics in India and Africa by the end of this year, after missing several earlier deadlines. "It's very disturbing," said Dr. Bruce Aylward, who heads the polio department at the World Health Organization.

This year, the number of polio cases caused by the vaccine has doubled: 124 children have so far been paralyzed, compared to 62 in 2008, out of about 42 million children vaccinated. For every case of paralysis, there are hundreds of other children who don't develop symptoms, but pass on the disease.

When Nigerian leaders suspended polio vaccination in 2003, believing the vaccine would sterilize their children and infect them with HIV, Nigeria exported polio to nearly two dozen countries worldwide, making it as far away as Indonesia.

Nigeria resumed vaccinations in 2004 after tests showed the vaccine was not contaminated with estrogen, anti-fertility agents or HIV.

Experts have long believed epidemics unleashed by a vaccine's mutated virus wouldn't last since the vaccine only contains a weakened virus strain but that assumption is coming under pressure. Some experts now say that once viruses from vaccines start circulating they can become just as dangerous as wild viruses.

"The only difference is that this virus was originally in a vaccine vial," said Olen Kew, a virologist at the U.S. Centers for Disease Control and Prevention.

The oral polio vaccine used in Nigeria and elsewhere contains a mild version of the live virus. Children who have been vaccinated pass the virus into the water supply through urine or feces. Other children who then play in or drink that water pick up the vaccine's virus, which gives them some protection against polio.

But in rare instances, as the virus passes through unimmunized children, it can mutate into a strain dangerous enough to ignite new outbreaks, particularly if immunization rates in the rest of the population are low.

Kew said genetic analysis proves mutated viruses from the vaccine have caused at least seven separate outbreaks in Nigeria.

Though Nigeria's coverage rates have improved, up to 15 percent of children in the north still haven't been vaccinated against polio. To eradicate the disease, officials need to reach about 95 percent of the population.

Nigeria's vaccine-linked outbreak underlines the need to stop using the oral polio vaccine as soon as possible, since it can create the very epidemics it was designed to stop, experts say. WHO is researching other vaccines that might work better, but none is on the horizon.

Until a better vaccine is ready, WHO and U.S. CDC officials say the oral vaccine is the best available tool to eradicate polio and that when inoculation rates are nearly 100 percent it works fine.

"Nigeria is almost a case study in what happens when you don't follow the recommendations," Kew said.

Since WHO and partners began their attempt to rid the world of polio in 1988, officials have slashed the disease's incidence by more than 99 percent.

But numerous deadlines have been missed and the number of cases has been at a virtual standstill since 2000. Critics have also wondered whether it is time to give up, and donors may be sick of continuing to fund a program with no clear endgame.

"Eradication is a gamble," said Scott Barrett, an economist at Columbia University who has studied polio policies. "It's all or nothing ... and there is a very real risk this whole thing may fall apart."

Aside from Nigeria, polio persists in a handful of other countries, including Afghanistan, Pakistan, India, Chad, Angola and Sudan.

Aylward agreed the Nigeria situation was another unwelcome hurdle, but was confident eradication was possible. "We still have a shot," he said. "We're throwing everything at it including the kitchen sink."


http://news.yahoo.com/s/ap/20090814/ap_on_...d_polio_nigeria (http://news.yahoo.com/s/ap/20090814/ap_on_re_af/af_med_polio_nigeria)

***

"In 2002, poliovirus was synthesized by a research team at the University of New York in Stony Brook. Hammond writes that "researchers built poliovirus 'from scratch' through chemical synthesis. Starting with the gene sequence of the agent, which is available online, the researchers synthesized virus sequences in the lab and ordered other tailor-made DNA sequences from a commercial source. They then combined them to form the full polio genome. In a last step, the DNA-sequence was brought to life by adding a chemical cocktail that initiated the production of
a living, pathogenic virus.

The experiment was funded by the US Defense Advanced Research Projects Agency (DARPA)."

In "Emerging Technologies: Genetic Engineering and Biological Weapons", post #58

in a running thread on the swine flu "question" over here:
http://www.commongroundcommonsense.org/forums/index.php?showtopic=110158

Magda Hassan
08-16-2009, 04:54 AM
And you can't sue for damages if you get this disease.
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~

Swine flu jab link to killer nerve disease: Leaked letter reveals concern of neurologists over 25 deaths in America



By Jo Macfarlane (http://www.dailymail.co.uk/home/search.html?s=y&authornamef=Jo+Macfarlane)



http://i.dailymail.co.uk/i/pix/2009/08/15/article-1206807-0610161C000005DC-936_233x423.jpg Prevention: Is the swine flu jab safe?


A warning that the new swine flu jab is linked to a deadly nerve disease has been sent by the Government to senior neurologists in a confidential letter.
The letter from the Health Protection Agency, the official body that oversees public health, has been leaked to The Mail on Sunday, leading to demands to know why the information has not been given to the public before the vaccination of millions of people, including children, begins.

It tells the neurologists that they must be alert for an increase in a brain disorder called Guillain-Barre Syndrome (GBS), which could be triggered by the vaccine.
GBS attacks the lining of the nerves, causing paralysis and inability to breathe, and can be fatal.

The letter, sent to about 600 neurologists on July 29, is the first sign that there is concern at the highest levels that the vaccine itself could cause serious complications.
It refers to the use of a similar swine flu vaccine in the United States in 1976 when:



More people died from the vaccination than from swine flu.
500 cases of GBS were detected.
The vaccine may have increased the risk of contracting GBS by eight times.
The vaccine was withdrawn after just ten weeks when the link with GBS became clear.
The US Government was forced to pay out millions of dollars to those affected.

Concerns have already been raised that the new vaccine has not been sufficiently tested and that the effects, especially on children, are unknown.
It is being developed by pharmaceutical companies and will be given to about 13million people during the first wave of immunisation, expected to start in October.
Top priority will be given to everyone aged six months to 65 with an underlying health problem, pregnant women and health professionals.
The British Neurological Surveillance Unit (BNSU), part of the British Association of Neurologists, has been asked to monitor closely any cases of GBS as the vaccine is rolled out.
One senior neurologist said last night: I would not have the swine
flu jab because of the GBS risk.

There are concerns that there could be a repeat of what became known as the 1976 debacle in the US, where a swine flu vaccine killed 25 people more than the virus itself.
A mass vaccination was given the go-ahead by President Gerald Ford because scientists believed that the swine flu strain was similar to the one responsible for the 1918-19 pandemic, which killed half a million Americans and 20million people worldwide.
http://i.dailymail.co.uk/i/pix/2009/08/08/article-0-05FD999F000005DC-992_468x286.jpg
The swine flu vaccine being offered to children has not been tested on infants
Within days, symptoms of GBS were reported among those who had been immunised and 25 people died from respiratory failure after severe paralysis. One in 80,000 people came down with the condition. In contrast, just one person died of swine flu.

More than 40million Americans had received the vaccine by the time the programme was stopped after ten weeks. The US Government paid out millions of dollars in compensation to those affected.

The swine flu virus in the new vaccine is a slightly different strain from the 1976 virus, but the possibility of an increased incidence of GBS remains a concern.

Shadow health spokesman Mike Penning said last night: The last thing we want is secret letters handed around experts within the NHS. We need a vaccine but we also need to know about potential risks.

Our job is to make sure that the public knows whats going on. Why
is the Government not being open about this? Its also very worrying if GPs, who will be administering the vaccine, arent being warned.

Two letters were posted together to neurologists advising them of the concerns. The first, dated July 29, was written by Professor Elizabeth Miller, head of the HPAs Immunisation Department.
It says: The vaccines used to combat an expected swine influenza pandemic in 1976 were shown to be associated with GBS and were withdrawn from use.

GBS has been identified as a condition needing enhanced surveillance when the swine flu vaccines are rolled out.
Reporting every case of GBS irrespective of vaccination or disease history is essential for conducting robust epidemiological analyses capable of identifying whether there is an increased risk of GBS in defined time periods after vaccination, or after influenza itself, compared with the background risk.

The second letter, dated July 27, is from the Association of British Neurologists and is written by Dr Rustam Al-Shahi Salman, chair of its surveillance unit, and Professor Patrick Chinnery, chair of its clinical research committee.

http://i.dailymail.co.uk/i/pix/2009/08/15/article-1206807-060783C1000005DC-36_468x382.jpg Halted: The 1976 US swine flu campaign


It says: Traditionally, the BNSU has monitored rare diseases for long periods of time. However, the swine influenza (H1N1) pandemic has overtaken us and we need every members involvement with a new BNSU survey of Guillain-Barre Syndrome that will start on August 1 and run for approximately nine months.
Following the 1976 programme of vaccination against swine influenza in the US, a retrospective study found a possible eight-fold increase in the incidence of GBS.

Active prospective ascertainment of every case of GBS in the UK is required. Please tell BNSU about every case.

You will have seen Press coverage describing the Governments concern about releasing a vaccine of unknown safety.

If there are signs of a rise in GBS after the vaccination programme begins, the Government could decide to halt it.

GBS attacks the lining of the nerves, leaving them unable to transmit signals to muscles effectively.
It can cause partial paralysis and mostly affects the hands and feet. In serious cases, patients need to be kept on a ventilator, but it can be fatal.

Death is caused by paralysis of the respiratory system, causing the victim to suffocate.
It is not known exactly what causes GBS and research on the subject has been inconclusive.
However, it is thought that one in a million people who have a seasonal flu vaccination could be at risk and it has also been linked to people recovering from a bout of flu of any sort.

The HPA said it was part of the Governments pandemic plan to monitor GBS cases in the event of a mass vaccination campaign, regardless of the strain of flu involved.
But vaccine experts warned that the letters proved the programme was a guinea-pig trial.

Dr Tom Jefferson, co-ordinator of the vaccines section of the influential Cochrane Collaboration, an independent group that reviews research, said: New vaccines never behave in the way you expect them to. It may be that there is a link to GBS, which is certainly not something I would wish on anybody.

But it could end up being anything because one of the additives in one of the vaccines is a substance called squalene, and none of the studies weve extracted have any research on it at all.

He said squalene, a naturally occurring enzyme, could potentially cause so-far-undiscovered side effects.

Jackie Fletcher, founder of vaccine support group Jabs, said: The Government would not be anticipating this if they didnt think there was a connection. What weve got is a massive guinea-pig trial.

Professor Chinnery said: During the last swine flu pandemic, it was observed that there was an increased frequency of cases of GBS. No one knows whether it was the virus or the vaccine that caused this.

The purpose of the survey is for us to assess rapidly whether there is an increase in the frequency of GBS when the vaccine is released in the UK. It also increases consultants awareness of the condition.
http://i.dailymail.co.uk/i/pix/2009/08/06/article-0-05DD694D000005DC-83_468x294.jpg
Panic over? The number of swine flu cases has fallen sharply in the past few weeks
This is a belt-and-braces approach to safety and is not something people should be substantially worried about as its a rare condition.

If neurologists do identify a case of GBS, it will be logged on a central database.

Details about patients, including blood samples, will be collected and monitored by the HPA.

It is hoped this will help scientists establish why some people develop the condition and whether it is directly related to the vaccine.

But some question why there needs to be a vaccine, given the risks. Dr Richard Halvorsen, author of The Truth About Vaccines, said: For people with serious underlying health problems, the risk of dying from swine flu is probably greater than the risk of side effects from the vaccine.

But it would be tragic if we repeated the US example and ended up with more casualties from the jabs.

I applaud the Government for recognising the risk but in most cases this is a mild virus which needs a few days in bed. Id question why we need a vaccine at all.

Professor Miller at the HPA said: This monitoring system activates pandemic plans that have been in place for a number of years. Well be able to get information on whether a patient has had a prior influenza illness and will look at whether influenza itself is linked to GBS.

We are not expecting a link to the vaccine but a link to disease, which would make having the vaccine even more important.

The UKs medicines watchdog, the Medicines and Healthcare Products Regulatory Agency, is already monitoring reported side effects from Tamiflu and Relenza and it is set to extend that surveillance to the vaccine.

A Department of Health spokesperson said: The European Medicines Agency has strict processes in place for licensing pandemic vaccines.

In preparing for a pandemic, appropriate trials to assess safety and the immune responses have been carried out on vaccines very similar to the swine flu vaccine. The vaccines have been shown to have a good safety profile.
It is extremely irresponsible to suggest that the UK would use a vaccine without careful consideration of safety issues. The UK has one of the most successful immunisation programmes in the world.
I COULDN''T EAT OR SPEAK... IT WAS HORRENDOUS

http://i.dailymail.co.uk/i/pix/2009/08/15/article-1206807-0611C622000005DC-148_233x458.jpg Victim: Hilary Wilkinson spent three months in hospital after she was diagnosed with Guillain-Barre Syndrome
When Hilary Wilkinson woke up with muscle weakness in her left arm and difficulty breathing, doctors initially put it down to a stroke.

But within hours, she was on a ventilator in intensive care after being diagnosed with Guillain-Barre Syndrome.

She spent three months in hospital and had to learn how to talk and walk again. But at times, when she was being fed through a drip and needed a tracheotomy just to breathe, she doubted whether she would survive.
The mother of two, 57, from Maryport, Cumbria, had been in good health until she developed a chest infection in March 2006. She gradually became so weak she could not walk downstairs.
Doctors did not diagnose Guillain-Barre until her condition worsened in hospital and tests showed her reflexes slowing down. It is impossible for doctors to know how she contracted the disorder, although it is thought to be linked to some infections.
Mrs Wilkinson said: It was very scary. I couldnt eat and I couldnt speak. My arms and feet had no strength and breathing was hard.
I was treated with immunoglobulin, which are proteins found in blood, to stop damage to my nerves. After ten days, I still couldnt speak and had to mime to nurses or my family.

It was absolutely horrendous and I had no idea whether I would get through it. You reach very dark moments at such times and wonder how long it can last.

But Im a very determined person and I had lots of support.

After three weeks, she was transferred to a neurological ward, where she had an MRI scan and nerve tests to assess the extent of the damage.

Still unable to speak and in a wheelchair, Mrs Wilkinson eventually began gruelling physiotherapy to improve her muscle strength and movement but it was exhausting and painful.
Three years later, she is almost fully recovered. She can now walk for several miles at a time, has been abroad and carries out voluntary work for a GBS Support Group helpline.

She said: It makes me feel wary that the Government is rolling out this vaccine without any clear idea of the GBS risk, if any. I wouldnt wish it on anyone and it certainly changed my life.

Im frightened to have the swine flu vaccine if this might happen again its a frightening illness and I think more research needs to be done on the effect of the vaccine.

Hotline staff given access to confidential records

Confidential NHS staff records and disciplinary complaints could be accessed by hundreds of workers manning the Governments special swine flu hotline.

They were able to browse through a database of emails containing doctors and nurses National Insurance numbers, home addresses, dates of birth, mobile phone numbers and scanned passport pages all details that could be used fraudulently.

And private and confidential complaints sent by hospitals about temporary medical staff some of whom were named were also made available to the call-centre workers, who were given a special password to log in to an internal NHS website.

It could be a breach of the Data Protection Act.
The hotline staff work for NHS Professionals, which was set up using taxpayers money to employ temporary medical and administrative staff for the health service.

The not-for-profit company runs two of the Governments swine flu call centres with 300 staff in Farnborough, Hampshire, and 900 in Watford, Hertfordshire.
Shadow Health Secretary Andrew Lansley described the revelations as disturbing.

Anne Mitchell, a spokeswoman for Unison, said: Theres no excuse for such a fundamental breach of personal security. Action needs to be taken as soon as possible to make sure this does not happen again.

A spokeswoman for NHS Professionals would not confirm whether access to the confidential files had been granted.


http://www.dailymail.co.uk/news/article-1206807/Swine-flu-jab-link-killer-nerve-disease-Leaked-letter-reveals-concern-neurologists-25-deaths-America.html

Jan Klimkowski
08-21-2009, 07:16 PM
Healthy people with swine flu do not need Tamiflu, says WHO

Healthy people who catch swine flu need not be given Tamiflu, the World Health Organisation (WHO) has announced. The advice appears to contradict the UK's policy of making the antiviral drug readily available to those who call the national pandemic helpline or approach their GPs.

Hundreds of thousands of doses have been given to British patients although the majority have not been severely ill. Fears have been voiced that mass use of Tamiflu will make the virus resistant to it.

The latest advice from the WHO said: "Worldwide, most patients infected with the pandemic virus continue to experience typical influenza symptoms and fully recover within a week, even without any form of medical treatment. Healthy patients with uncomplicated illness need not be treated with antivirals."

Previously the WHO had said antivirals should be given to patients with "serious progressive illness". The new guidance is the first time it has specifically advised against otherwise healthy individuals being given the drug.

The recommendation is based on the conclusion of an international panel of experts that includes representatives from the UK. The advice added that Tamiflu, also called oseltamivir, and the similar drug Relenza, also called zanamivir, should be given quickly to seriously ill or deteriorating patients.

The WHO guidance said at-risk groups should receive the drugs. "For patients with underlying medical conditions that increase the risk of more severe disease, WHO recommends treatment with either oseltamivir or zanamivir.

"These patients should also receive treatment as soon as possible after symptom onset, without waiting for the results of laboratory tests. As pregnant women are included among groups at increased risk, WHO recommends that they receive antiviral treatment as soon as possible after symptom onset."

Some medical researchers have expressed concern about the side-effects of Tamiflu, particularly sickness, nightmares and insomnia in children. A team from Oxford University said this month that children with mild symptoms should not be given Tamiflu and urged the Department of Health (DoH) to urgently rethink its policy.

Figures released by the DoH show that 45,986 courses of antivirals were given to patients in England in the week ending 18 August. In the previous week 90,363 courses of antivirals were given out. The data relates to people collecting the drugs after an assessment via the National Pandemic Flu Service. Many more have collected antivirals via their GP.

The DoH said the new WHO guidance was not too different from its own position that people with mild symptoms could recover without antiviral drugs.

The new WHO statement said: "Worldwide, around 40% of severe cases are now occurring in previously healthy children and adults, usually under the age of 50 years. Some of these patients experience a sudden and very rapid deterioration in their clinical condition, usually on day five or six following the onset of symptoms."

The first deaths of patients in Wales and Northern Ireland with swine flu has been announced, bringing the number of UK deaths to 61. In Wales, a 55-year-old woman was admitted to the Royal Gwent hospital in Newport on 2 August and given antiviral drugs. She developed cardiac problems and died on Saturday.

In Northern Ireland, a female patient who was said to have had an underlying health condition died last night in hospital. No further details were released.

The Department of Health has hinted that accumulating evidence about the degree of severity of the outbreak might lead to a change in policy. A spokesman said: "We believe a safety-first approach of offering antivirals, when required, to everyone remains a sensible and responsible way forward. However we will keep this policy under review as we learn more about the virus and its effects."

"The WHO recommendations are in fact in line with UK policy on antivirals. We have consistently said that many people with swine flu only get mild symptoms and they may find bed rest and over-the-counter flu remedies work for them.

"WHO state that 40% of severe cases worldwide have been in previously healthy children and adults and that serious cases should be treated immediately. This emphasises the need not to become complacent about the mildness of the illness and the reasoning behind a precautionary policy.

"People with underlying health conditions, pregnant women and parents with children under the age of one should speak to their GP if they have symptoms. If people have any doubts about taking antivirals they should contact their GP."



http://www.guardian.co.uk/world/2009/aug/21/tamiflu-swine-flu-healthy

:flute:

Ed Jewett
08-25-2009, 04:13 AM
A Dark Winter for Public Health: Meet Homeland Securitys New Bioterror Czarina

by Tom Burghardt / August 24th, 2009

In the wake of the 2001 anthrax attacks, successive U.S. administrations have pumped some $57 billion across 11 federal agencies and departments into what is euphemistically called biodefense. Speaking at the World Economic Forum in Davos, Switzerland in January 2005, former U.S. Senate Majority Leader William Frist, a Bushist acolyte, baldly stated that The greatest existential threat we have in the world today is biological and predicted that an inevitable bioterror attack would come at some time in the next 10 years.
Later that year, Frist and former House Speaker Dennis Hastert (R-IL) covertly inserted language into the 2006 Defense Appropriations bill (H.R. 2863) that granted legal immunity to vaccine manufacturers, even in cases of willful misconduct. It was signed into law by President Bush.
According to Public Citizen (http://www.citizen.org/pressroom/release.cfm?ID=2102) and The New York Times (http://query.nytimes.com/gst/fullpage.html?sec=health&res=9F0DE3DA1730F933A15751C1A9639C8B63), Frist and Hastert benefited financially from their actions; the pair, as well as 41 other congressmen and senators owned as much as $16 million in pharmaceutical stock. revealed that the Biotechnology Industry Organization (BIO (http://www.bio.org/)) is purported to be the key author of the language additions. This trade association represents virtually all major vaccine manufacturers.
The Senate Majority Leaders alarmist jeremiad at Davos was seconded by Dr. Tara OToole who added, This is one of the most pressing problems we have on the planet today.
Really? Not grinding poverty, global warming or the lack of access by hundreds of millions of impoverished workers and farmers to clean water, an adequate diet, health care or relief from epidemic levels of preventable diseases such as malaria, tuberculosis or diarrhea, but bioterrorism as narrowly defined by securocrats and their academic accomplices.
But Dr. Victor W. Sidel, a founder of Physicians for Social Responsibility (PSR (http://www.psr.org/)) and an outspoken critic of the Bioweapons-Industrial-Complex challenged OTooles hysterical paradigm.
Sidel made the point that there is a fundamental conflict between the states national security goals and health care providers professional responsibilities to patients. He wrote in 2003 that military, intelligence, and law enforcement agencies and personnel have long histories of secrecy and deception that are contrary to the fundamental health principles of transparency and truthfulness. They may therefore be unsuitable partners for public health agencies that need to justify receiving the publics trust.
In this context, the choice of OToole as the Department of Homeland Securitys (DHS) Undersecretary of Science and Technology is troubling to say the least. As former CEO and Director of UPMCs Center for Biosecurity, critics charge that OTooles appointment will be nothing short of a disaster.
No ordinary policy wonk with an impressive rsum and years as a government insider, OToole is a key player advocating for the expansion of dual-use biological weapons programs rebranded as biodefense.
[B]Subverting the Biological Weapons Convention
The resuscitation of American bioweapons programs are facilitated by their secretive and highly-classified nature. Under cover of academic freedom or intellectual property rights, the U.S. Bioweapons-Industrial-Complex has largely been outsourced by the state to private companies and contractors at top American corporations and universities.
Efforts to strengthen the Biological Weapons Convention (BWC) by the inclusion of verification language into the treaty and regular inspection of suspect facilities by international experts have been shot-down since 2001 by the Bush and now, the Obama administrations. Why?
Primarily because the United States view onsite measures as a threat to the commercial proprietary information of multinational pharmaceutical and biotechnology companies as well as to Americas reputedly defensive biological programs; initiatives that continue to work with natures most dangerous and deadly pathogens.
In fact, the problem of the dual-use nature of such research is a conundrum facing critics who challenge the break-neck expansion of concealed weapons programs. Simply put, military activities can be disguised as commercial research to develop medical countermeasures without anyone, least of all the American people, being any the wiser.
Highly-trained microbiologists deployed across a spectrum of low-key companies, trained for academic, public health, or commercial employment are part of the dual-use problem. Whos to say whether scientists who genetically-manipulate pathogens or create Frankenstein-like chimera disease organisms (say, synthesized Marburg or Ebola virus as has already been done with poliovirus in a U.S. lab) are engaged in treaty-busting weapons research or the development of life-saving measures.
And what about the accidental, or more sinisterly, the deliberate release of some horrific new plague by a scientist whos gone rogue? As researcher Edward Hammond pointed out:
British researchers pled guilty in 2001 to charges that they improperly handled a genetically engineered hybrid of the viruses causing hepatitis C and dengue fever. British authorities characterized the virus as more lethal than HIV. Dengatitis was deliberately created by researchers who wanted to use fewer laboratory animals in a search for a vaccine for Hepatitis C. Under unsafe laboratory conditions, the researchers created and nearly accidentally released a new hybrid human disease whose effects, fortunately, remain unknown; but which may have displayed different symptoms than its parents and thus been difficult to diagnose, and have required a new, unknown treatment regime. (Emerging Technologies: Genetic Engineering and Biological Weapons, The Sunshine Project (http://www.sunshine-project.org/), Background Paper No. 12, November 2003)
A new report (http://www.armscontrolcenter.org/policy/biochem/articles/bwc_compliance.pdf) by the Center for Arms Control and Nonproliferation has charged that despite restrictions under the BWC prohibiting the development, production, stockpiling and use of weaponized disease agents such as anthrax, smallpox or plague, as well as equipment and delivery systems intended for offensive use, the rapid growth of biodefense and research programs over the last decade has placed new pressure on efforts to curb the development of banned weapons listed in the treaty.
In an interview (http://gsn.nti.org/gsn/nw_20090820_6796.php) with Global Security Newswire Gerald Epstein, a senior fellow with the hawkish Center for Security and International Studies (CSIS) told the publication, When one is doing bioresearch and biodefense, one has to be careful to not overstep the treaty itself.
He cited the U.S biodefense effort Project Bacchusan investigation by the Defense Threat Reduction Agency to determine whether it was possible to build a bioweapons production facility using readily available equipmentas an instance where questions were raised if the treaty had been violated.
The type of biodefense activity that is most likely to raise questions regarding treaty compliance is threat assessment, the process of determining what type of biological attacks are most likely to occur, he told Global Security Newswire. A dangerous biological agent could inadvertently be developed during such research, Epstein said. (Martin Matishak, Biodefense Research Could Violate Weapons Convention, Report Warns, Global Security Newswire, August 20, 2009)
But Pentagon bioweaponeers did more than build a bioweapons productions facility using readily available equipment. They built banned weapons. According to Jeanne Guillemin, author of Biological Weapons: From the Invention of State-Sponsored Programs to Contemporary Bioterrorism, the Pentagon and CIA made and tested a model of a Soviet anthrax bomb and created an antibiotic-resistant strain of anthrax.
After consulting with scientists who strongly suggested that the CIA anthrax bomb project would violate the BWC, CIA lawyers decided the project was within the allowed realm of defensive research, Guillemin revealed. Project Clear Vision, a joint investigation by the CIA and the Battelle Memorial Institute, under contract to the Agency, reconstructed and tested a Soviet-era anthrax bomblet in order to test its dissemination characteristics. The Agency decided the same for the small, fully functional bioweapons facility built under the rubric of Project Bacchus.
The third initiative, Project Jefferson, led to the development of an antibiotic-resistant strain of anthrax based on a Soviet model. After the outgoing Clinton administration hesitated to give the CIA the go-ahead for the project, the Bush regimes National Security Council gave the Pentagon permission. They believed Guillemin wrote, the Pentagon had the right to investigate genetically altered pathogens in the name of biodefense, to save American lives.
Shortly thereafter, the Pentagon authorized the Defense Intelligence Agency (DIA), one of the most secretive and heavily-outsourced Defense Department branches, to re-create the deadly anthrax strain.
What the scope of these programs are today is currently unknown. We do know however, that based on available evidence the Department of Homeland Security, the Defense Department and the oxymoronic Intelligence Community, using the Department of Health and Human Services (HHS) and the U.S. Department of Agriculture (USDA) as a cover, continue to investigate the feasibility of transforming natures most deadly pathogens into weapons.
In close coordination, the United States government and their outsourced corporate partners are spending billions of dollars on research and simulation exercises, dubbed disaster drills by a compliant media, to facilitate this grisly trade.
Secrecy and Deceit
That the official bioterror narrative is a preposterous fiction and swindle as even the FBI was forced to admit during its much-maligned Amerithrax investigation, is hardly worth a second glance by corporate media beholden to the pharmaceutical industry for advertising revenue; call it business as usual here in the heimat.
As we now know, the finely-milled anthrax powder which killed five people and shut down representative government didnt come from the Afghan-Arab database of disposable Western intelligence assets known as al Qaeda, but rather from deep within Americas own Bioweapons-Industrial-Complex, to wit, from the U.S. Army Medical Research Institute of Infectious Diseases (USAMRIID) at Ft. Detrick in Maryland. But such troublesome and inconvenient truths are barely worth a mention by respectable media, e.g. the corporate stenographers who sold two imperialist military adventures to the American people.
Indeed, a credible case can be made that without the anthrax attacks, the fear levels gripping the country in the wake of the 9/11 terrorist eventsand the subsequent clamp-down that followed, from the USA Patriot Act to the indefinite detention and torture of terrorism suspects, and from warrantless wiretapping to the demonization of dissentmay very well have been impossible.
It is difficult not to conclude that from the beginning of the affair, there was a clear intent on the part of the anthrax terrorist(s) to draw a straight line between 9/11 and the anthrax mailings. From there, it was but a short step to stitching-up a case for regime change in Iraq. The medias role in this criminal enterprise was indispensable for what Salons Glenn Greenwald has called (http://www.salon.com/opinion/greenwald/2008/08/01/anthrax/index.html)the single greatest, unresolved media scandal of this decade. As Greenwald points out,
During the last week of October, 2001, ABC News, led by Brian Ross, continuously trumpeted the claim as their top news story that government tests conducted on the anthraxtests conducted at Ft. Detrickrevealed that the anthrax sent to [former Senator Tom] Daschle contained the chemical additive known as bentonite. ABC News, including Peter Jennings, repeatedly claimed that the presence of bentonite in the anthrax was compelling evidence that Iraq was responsible for the attacks, sinceas ABC variously claimedbentonite is a trademark of Iraqi leader Saddam Husseins biological weapons program and only one country, Iraq, has used bentonite to produce biological weapons. (Glenn Greenwald, Vital unresolved anthrax questions and ABC News, Salon, August 1, 2008)
Despite ABC News claims that their information came from four well-placed and separate sources, they were fed information that was patently false; as Greenwald avers, No tests ever found or even suggested the presence of bentonite. The claim was just concocted from the start. It just never happened.
And as we will shortly explore below, the dubious Dark Winter and Atlantic Storm bioterror exercises designed by Dr. Tara OToole freely drew from the neocons sinister playbook, right down to the weaponized smallpox supplied to al Qaeda by Saddam.
Whether or not one buys the current permutation of the lone nut theory, this one alleges that Dr. Bruce Ivins, a vaccine specialist employed by USAMRIID, was the anthrax mailer; the fact is, when all is said and done the attacks, to use a much over-hyped phrase, were an inside job.
And like other lone nuts who have entered the parapolitical frame at their own peril, Ivins isnt around to refute the charges.
The Alliance for Biosecurity: Insiders with a Mission and (Very) Deep Pockets
Before being pegged by the Obama administration to head DHSs Science and Technology division where she will oversee the departments billion dollar budget, with some 45 percent of it going towards chemical and bioweapons defense, OToole, as previously mentioned, was the CEO and Director of UPMCs Center for Biosecurity, a satrapy which describes itself as an independent organization dedicated to improving the countrys resilience to major biological threats.
How independent? You make the call!
According to their web site (http://www.upmc-biosecurity.org/website/special_topics/alliance_for_biosecurity/) The Alliance for Biosecurity is a collaboration among the Center for Biosecurity and 13 pharmaceutical and biotechnology companies whose mission is to work in the public interest to improve prevention and treatment of severe infectious diseasesparticularly those diseases that present global security challenges.
Alliance partners include the usual suspects: Bavarian Nordic; Center for Biosecurity of UPMC; Cangene Corporation; DOR BioPharma, Inc.; DynPort Vaccine Company LLC, a CSC company; Elusys Therapeutics, Inc.; Emergent BioSolutions; Hematech, Inc., a subsidiary of Kyowa Kirin; Human Genome Sciences, Inc.; NanoViricides, Inc.; Pfizer Inc.; PharmAthene; Siga Technologies, Inc.; Unither Virology LLC, a subsidiary of United Therapeutics Corporation. Rounding out this rogues gallery are associate members, the spooky Battelle Medical Research and Evaluation Facility and the Lovelace Respiratory Research Institute.
Among the chief activities of the Alliance is lobbying Congress for increased funding for the development of new drugs deemed countermeasures under the Project BioShield Act of 2004 (http://frwebgate.access.gpo.gov/cgi-bin/getdoc.cgi?dbname=108_cong_public_laws&docid=f:publ276.108.pdf), previously described by Antifascist Calling (http://antifascist-calling.blogspot.com/2009/08/obama-administration-revives-bush-era.html) as a particularly grotesque piece of Bushist legislative flotsam.
The Alliance avers that the United States faces unprecedented risks to national security by the clear and growing danger of bioterrorism or a destabilizing infectious disease pandemic, and that our nations vulnerability to biothreats is so severe due to the fact that most of the vaccines and medicines that will be needed to protect our citizens do not now exist. Therefore, countermeasures needed to mitigate nebulous biothreats never spelled out once in the groups literature will likely require several years and several hundred million dollars each to successfully develop and produce. (emphasis added)
An Alliance report (http://www.upmc-biosecurity.org/website/special_topics/alliance_for_biosecurity/reports/2008_State_of_Biosecurity.pdf), The State of Biosecurity in 2008 and Proposals for a Public/Private Pathway Forward, charts a course for improving and accelerating efforts to develop medical countermeasures (MCMs) for the nations Strategic National Stockpile (SNS).
Under the Project Bioshield Act of 2004, Congress authorized $5.6 billion over ten years to purchase MCMs for the SNS. Funds were allocated for the procurement of the anthrax vaccine as well as for therapeutic antibodies for inhalational anthrax, a botulism heptavalent antitoxin, a smallpox vaccine, and several products for radiological and nuclear threats, obligating a total of about $1.9 billion of the $5.6 billion BioShield fund.
In 2006 as I noted previously, Congress created the Biomedical Advanced Research and Development Authority (BARDA) within the Department of Health and Human Services (HHS). BARDA was authorized to spend some $1.07 billion over three years for MCMs, only $201 million has been provided by Congress through FY 2008? noted the Alliance, approximately one-fifth of the authorized level.
According to an independent economic analysis carried out by (who else!) the Alliances academic partner, the Center for Biosecurity, it would require $3.4 billion in FY 2009 to support one year of advanced development.
Similarly according to the organization, the original appropriation of $5.6 billion for Project BioShield is equally insufficient to ensure that once MCMs are developed there will be funds available to procure them and maintain the stockpile. Indeed, this level of funding would need to be sustained for many years. You can bet however, that Alliance lobbyists are busy as proverbial bees in pressuring Congress to fork over the dough!
The report states that Alliance goals necessarily entail instilling a sense of urgency with Congress by hyping the bioterror threat. But theres much more here than a simple cynical exercise at preparing the public diplomacy ground through academic and industry message force multipliers that will enable Congress to shower Big Pharma with a veritable tsunami of cash. A risk-tolerant culture should be promoted within BARDA, one that understands the realities, risks, timelines, and costs of drug development.
The risks to whom and for what purpose are not enumerated, but one can be certain that a risk-tolerant culture crafted by industry insiders will come at the expense of the health and safety of the American people, one that pushes potential legal liability should things head south onto the taxpaying public.
The stealth nature of Alliance recommendations are clearly spelled out when they aver that stakeholders should focus more on the potential biothreats and the corresponding countermeasures, rather than the price tag and that BARDA, ostensibly a public agency, should be packed with insiders who have drug development and manufacturing experience. This will lead to the development of a culture that is focused on partnering with industry and academia.
But the bottom line as always, is the corporatist bottom line for Alliance shareholders! How else can one interpret their statement that emerging biothreats are all the more dire today now that interest of the public and private capital markets in biodefense has declined over the last 2-3 years. What better way then, to beef-up those sagging capital markets than to install an industry-friendly individual at DHS with a documented track record of overplaying the bioterror threat.
Dark Winter
OToole was the principal designer of two tabletop bioterror preparedness drills, the 2001 Dark Winter exercise and the 2005 Atlantic Storm run-through; both were criticized by scientific experts as fabrications of an alleged threat of a smallpox attack mounted by al Qaeda.
Reviewing Milton Leitenbergs 2005 report (http://www.strategicstudiesinstitute.army.mil/Pubs/display.cfm?PubID=639), Assessing the Biological Weapons and Bioterrorism Threat, published the U.S. Army War Colleges Strategic Studies Institute, protein chemist Dr. Eric Smith wrote (http://www.globalsecurity.org/org/nsn/nsn-060331.htm) the following:
Of note is Leitenbergs dissection of the process of assessment as practiced through bioterrorism threat scenarios conducted by the US government and private think tanks. Exercises like Dark Winter, which modeled an aerosolized smallpox attack, Top Off 2 and 3, both on pneumonic plague strikes, and Atlantic Storm, an exercise that purported to show an al Qaida group manufacturing a dry powder smallpox weapon, were rigged. In the cases of Dark Winter and the Top Offs, transmission rates of disease were sexed up beyond historical averages so that a disastrous outcome was assured no matter any steps taken to contain outbreaks. Eight pages are reserved to pointedly condemn the Atlantic Storm exercise on a host of sins which can generally be described as a bundle of frank lies and misinformation coupled with a claimed terrorist facility for making smallpox into a weapon that even state run biological warfare operations did not possess. And once again, juiced transmission rates of disease were employed to grease theoretical calamity. The reader comes to recognize the deus ex machinaa concoction or intervention added to dictate an outcome, in these cases very bad onesas a regular feature of the exercises. However, the results of the same assessmentsthe alleged lessons learnedhave never been reported with much, if any, skepticism in the media. (Eric Smith, A Vaccine for the Hype: Milton Leitenbergs new Assessing the Biological Weapons and Bioterrorism Threat, Global Security, National Security Notes, March 31, 2006)
In criticizing the fancy that such attacks are easy and one of the most catastrophic threats faced by the American people, Smith denounces the alarmist scenarios of Dark Winter and Atlantic Storms designerspeople like Dr. Tara OToole and the coterie of industry insiders and other well-paid expertsas guilty of perpetrating a massive fraud and a substantial one on the American people.
While one of Atlantic Storms architects proclaimed this is not science fiction and that the age of Bioterror is now Leitenberg and Smith denounce OTooles spurious claims as not the least bit plausible.
Leitenberg wrote that well before October-November 2001, the spectre of bioterrorism benefitted from an extremely successful sales campaign. Indeed, hyped-up scenarios such as Dark Winter and Atlantic Storm that place weapons of mass destruction in the hands of shadowy, intelligence-linked terror outfits like al Qaeda provided inflated predictions that were certainly not realistic. Much worse, in addition to being wrong, inflated predictions were counterproductive. They induced interest in BW in the wrong audiences.
But the implausible nature of the scenarios deployed in national exercises hardly prohibited the Bioweapons-Industrial-Complex from concocting scarecrow-like straw men designed to sow terror amongst the American people while extracting regular infusions of cash from Congress.
Among the eight exercises analyzed by Leitenberg between 1998-2005, he found that each and every one were fraudulently designed and the threat of bioterrorism had been framed as a rationalization for political action, the expenditure of public funds for bioterrorism prevention and response programs, that could not occur without it. This is not benign, Leitenberg concludes.
A second consequence of sexed-up bioterror drills have even more ominous implications for the immediate future. Because of national security state perceptions that mitigation of catastrophic bioterrorism is of supreme importance for national survivalperceptions reinforced by academic, corporate and militarist peddlers of crisisthe US biodefense research program appears to be drifting into violation of the Biological Weapons Convention. This is a menacing development and has happened, I would argue precisely because the evaluation process which justifies research into biological weapons threat capabilities and scenarios, are repackaged to conceal the offensive thrust of this research as wholly defensive in nature, which it certainly is not.
How else would one explain ongoing research funded by the National Institutes of Health to study botulism toxin, with the added qualification Smith points out, that because the protein toxin is unstable, therefore there will be collaboration with other researchers to stabilize it. The NIH grant means preparing a much more effective botulinum toxin than had been available before.
Smith goes on to cite another problematical breakout offered by two scientists to study the aerobiological characteristics of the lethal Marburg and Ebola viruses. How this is defensive in nature, in keeping with research restrictions under the Biological Weapons Convention, is another instance of a backdoor move to kick-start illicit bioweapons development.
According to Smith, the study looks to define how the organisms can be aerosolized, an instance of research into examining vulnerability in the complete absence of a verified threat. But I would argue that showering taxpayers dollars into such dark and troubling research tributaries deploy hyped-up threats as cover for the development of illegal weapons.
When her nomination was announced in May, Rutgers University and homeland security critic Richard Ebright told Wired (http://www.wired.com/dangerroom/2009/05/dhs-new-geek-in-chief-is-a-biodefense-disaster-critics-say/),
This is a disastrous nomination. OToole supported every flawed decision and counterproductive policy on biodefense, biosafety, and biosecurity during the Bush Administration. OToole is as out of touch with reality, and as paranoiac, as former Vice President Cheney. It would be hard to think of a person less well suited for the position.
She was the single most extreme person, either in or out of government, advocating for a massive biodefense expansion and relaxation of provisions for safety and security, he adds. She makes Dr. Strangelove look sane. (Noah Shachtman, DHS New Geek Chief is a Bioterror Disaster, Critics Charge, Wired, May 6, 2009)
And Dr. Smith told Wired that exercises designed by OToole and her colleagues show her to be the top academic/salesperson for the coming of apocalyptic bioterrorism which has never quite arrived.
As noted above, [She's] most prominent for always lobbying for more money for biodefense, conducting tabletop exercises on bioterrorism for easily overawed public officials, exercises tweaked to be horrifying, Smith told Wired.
But Smith goes even further and denounces OToole as an industry shill who has never obviously appeared to examine what current terrorist capabilities have been in favor of extrapolating how easy it would be to launch bioterror attacks if one had potentially unlimited resources and scientific know-how. Its a superb appointment if youre in the biodefense industry and interested in further opportunity and growth.
Alternatively Smith avers, OTooles appointment is a disaster if threat assessment and prevention has some basis in reality.
Not that any of this matters in Washington. The Senate Homeland Security and Governmental Affairs Committee led by independent Democrat and arch neocon Sen. Joseph Lieberman, voted to send her nomination to the full Senate July 29.
Never mind that the deadly weaponized pathogen employed in the attacks didnt originate in some desolate Afghan cave or secret underground bunker controlled by Saddam.
And never mind that the principal cheerleaders for expanding state-funded programs are Pentagon bioweaponeers, private corporations and a shadowy nexus of biosecurity apparatchiks who stand to make a bundle under current and future federal initiatives.
Leading the charge for increased funding is the Alliance for Biosecurity, a collaborative venture between the Center for Biosecurity of the University of Pittsburgh Medical Center (UPMC (http://www.upmc-biosecurity.org/)) and Big Pharma.


http://dissidentvoice.org/2009/08/a-dark-winter-for-public-health-meet-homeland-securitys-new-bioterror-czarina/

Ed Jewett
10-13-2009, 07:41 PM
I just discovered this archive of stuff over at Cryptome.

I have not read this at all. I'll just post the links:

http://cryptome.org/h1n1/cdc-flu-fuzz.htm

http://cryptome.org/h1n1/cdc-flu-fuzz2.htm

http://cryptome.org/h1n1/cdc-flu-fuzz3.htm

http://cryptome.org/h1n1/cdc-flu-fuzz4.htm

http://cryptome.org/h1n1/cdc-flu-fuzz5.htm

http://cryptome.org/h1n1/cdc-flu-fuzz6.htm

http://cryptome.org/h1n1/cdc-flu-fuzz7.htm

http://cryptome.org/h1n1/cdc-flu-fuzz8.htm

The person who sends this stuff (it is his analysis) is James Atkinson, current address and Phone # and web site and e-mail provided, and he is

ATKINSON JAMES M



Assn. Former Intelligence Officers. Membership Directory. 1996 (http://www.namebase.org/sources/EA.html)
Intelligence (Paris) (http://www.namebase.org/sources/MF.html) 1997-09-08 (10)

If you google his name, you will also find extended Congressional testimony
Before the House Committee on Transportation and Infrastructure
U.S. Coast Guard Budget and Oversight Hearing, April 18, 2007

I have only begin to review this stuff but, if I get the gist of it, he is suggesting that the CDC is to be found guilty of fuzzing the data on the H1N1 flu outbreak by failing to report its severity.

I will continue to look into this as I have the time (though I will be out a good deal of Tuesday, Wednesday and Friday this week).

Here's my question:

This material seems to run against much of the material I've seen about the flu/CDC/BigPharma debate, which tends along the lines of "the prospects of pandemic -- as well as the flu itself -- is 'man-made', and the vaccines are at least untested and full of squalene and other unknown junk" in which the CDC and WHO are made to be hyperventilating the threat so as to drive vaccination, purchase of vaccines, and other issues of mass public health management... whereas this material from Atkinson apparently says that the CDC is suppressing information about the severity of the matter. And this stuff is sent in by a former "spook".

Not all former spooks are bad guys, and I don't really have a feel for Crypytome yet. Given the fact that I am so out front and visible on this issue, I'd like to have some sense of WTFIGOH. Something in this mix is either wrong, or is disinformation. If this fellow Atkinson is right, then the implications are indeed horrifying; it would be a classic Cannae attack using both the disease and the cure.

All further discussion and insight is welcome and, given the gravity of the issues, desired.

David Guyatt
10-14-2009, 08:22 AM
ED, for what it may be worth, I think Cryptome is a great resource. Important information is leaked there. But, of course, it could also innocently host disinformation - but the founders are good, honest people imo.

Peter Presland
10-14-2009, 09:00 AM
Actually the 'Cryptome' website is more or less a one-man-band although hosted by Natsios Young, a firm of architects. That one man is John Young, a partner in the firm, who I personally identify with as pretty much a soul-mate. He has a deep, almost paranoid, distrust of authority and is congenitally sceptical in his dealings with any and everybody. "Why should I believe you?" is his default question to everyone with an axe to grind or a story to tell.

There's a good interview with him "Secrets and Lies. The man behind the world's most dangerous website' in Radar Mag (http://web.archive.org/web/20071011202610/http://radaronline.com/from-the-magazine/2007/08/cryptome_john_young_radar_anthony_haden_guest_1.ph p)

And I posted a brief piece he wrote about Wikileaks on DPF a while ago
(http://www.deeppoliticsforum.com/forums/showthread.php?t=1414&highlight=wikileaks)
I bought my first CD copy of the website about 4 years ago and have just done so again - It's a snip at $25.

Ed Jewett
10-14-2009, 03:18 PM
It was -- and still is -- my assumption that Cryptome's (or John Young's) intent was valid. It becomes more so to the extent that others chime in and say 'it has been my experience or my perspective that it is valid'. I don't know the 'sender' of the material; we can presume the same about him until proven otherwise. That said, then, what is going on inside the governmental/media/BigPharma machinery dealing with H1N1? If what we have seen in many venues is even partially accurate, what we have borders on conspiracy to commit mass murder, and worse. Is that what we are seeing, or do I need to get some "lens-cleaning" tissues for my mind?

Ed Jewett
11-02-2009, 03:15 PM
Thanks, Peter Presland, for posting that great Radar interview with John Young.

Magda Hassan
11-21-2009, 03:08 AM
Tamiflu-resistant swine flu spreads 'between patients'


By Fergus Walsh
Health correspondent, BBC News
http://newsimg.bbc.co.uk/shared/img/999999.gif

http://newsimg.bbc.co.uk/media/images/46767000/jpg/_46767311__46005163__45987312__45705292_tamiflu226 i-1-1-1.jpg Tamiflu is used to treat swine flu

Health officials say a Tamiflu-resistant strain of swine flu has spread between hospital patients.
Five patients on a unit treating people with severe underlying health conditions at the University Hospital of Wales, Cardiff, were infected.
Three appear to have acquired the infection in hospital.
They are thought to be the first confirmed cases of person-to-person transmission of a Tamiflu-resistant strain in the world.
There have been several dozen reports around the world of people developing resistance to Tamiflu while taking the drug - but they have not passed on the strain to others.
Just one possible cases of person-to-person transmission of a resistant strain has been recorded - between two people at a US summer camp - and this has never been confirmed.
Two of the University Hospital Wales patients have recovered and have been discharged from hospital, one is in critical care and two are being treated on the ward.
The health officials stressed there was no risk to anyone else.
They said tests were being carried out to confirm exactly what happened.
The UK has bought enough doses of Tamiflu, which can shorten the duration of swine flu and reduce the risk of complications, for half the population.
Serious concern
So any spread of a Tamiflu-resistant strain of the illness is a serious public health concern.
The H1N1 virus has been remarkably stable since it emerged in April, but virologists had been half expecting new resistant strains to emerge.
Dr Roland Salmon, director of the National Public Health Service for Wale's Communicable Disease Surveillance Centre, said: "The emergence of influenza A viruses that are resistant to Tamiflu is not unexpected in patients with serious underlying conditions and suppressed immune systems, who still test positive for the virus despite treatment.
"In this case, the resistant strain of swine flu does not appear to be any more severe than the swine flu virus that has been circulating since April."
Dr Tony Jewell, Chief Medical Officer for Wales, said: "We know that people with suppressed immune systems are more susceptible to the swine flu virus, which is why they are a priority group under the first phase of the vaccination programme in Wales which is progressing at pace.
"We have stringent processes in place for monitoring for antiviral resistance in the UK so that we can spot resistance early and the causes can be investigated and the cases managed.
"Identifying these cases shows that our systems are working so patients should be reassured.
"Treatment with Tamiflu is still appropriate for swine flu and people should continue to take Tamiflu when they are prescribed it.
"It's also important that good hygiene practices are followed to further prevent the spread of the virus."
Professor Peter Openshaw, a respiratory physician at Imperial College London, said of the spread: "It's not surprising that this has happened, indeed it has always been anticipated".
Dr Ronald Cutler, deputy director of biomedical science at Queen Mary, University of London, said: "Shortening the time taken to produce new vaccines and improving the methods to control and treat the disease while vaccines are being made would be a way forward".
On Thursday it was announced that more than three million healthy children under five across the UK will be offered the swine flu jab.
Figures released on Thursday showed an estimated 53,000 new cases of swine flu in England in the last week, down from 64,000 in the week before.
In Scotland, the figure was 21,200, down from about 21,500 in the previous seven days.
The rate of flu-like illnesses diagnosed by GPs in Wales dropped to 36 cases for every 100,000 people from 65.8 the previous week.

http://news.bbc.co.uk/2/hi/health/8370859.stm

Ed Jewett
11-25-2009, 04:58 PM
Scientist Repeats Swine Flu Lab-Escape Claim in Published Study (http://cryptogon.com/?p=12291)

November 25th, 2009 From where did the 2009 swine-origin influenza A virus (H1N1) emerge? (http://www.virologyj.com/content/pdf/1743-422x-6-207.pdf)
Virology Journal 2009, 6:207 doi:10.1186/1743-422X-6-207
Adrian J Gibbs, John S Armstrong, Jean C Downie
Via: Bloomberg (http://www.bloomberg.com/apps/news?pid=20601124&sid=ajw2AS.d1wK8):
Adrian Gibbs, the virologist who said in May that swine flu may have escaped from a laboratory, published his findings today, renewing discussion about the origins of the pandemic virus.
The new H1N1 strain, which was discovered in Mexico and the U.S. in April, may be the product of three strains from three continents that swapped genes in a lab or a vaccine-making plant, Gibbs, and fellow Australian scientists wrote in Virology Journal. The authors analyzed the genetic makeup of the virus and found its origin could be more simply explained by human involvement than a coincidence of nature.
Their study, published in a free, online journal reviewed by other scientists, follows debate among researchers six months ago, when Gibbs asked the World Health Organization to consider the hypothesis. After reviewing Gibbs initial three-page paper, WHO and other organizations concluded the pandemic strain was a naturally occurring virus and not laboratory-derived.
It is important that the source of the new virus be found if we wish to avoid future pandemics rather than just trying to minimize the consequences after they have emerged, Gibbs and colleagues John Armstrong and Jean Downie said in todays eight- page study.
Gibbs and Armstrong are on the emeritus faculty at the Australian National University in Canberra and Downie is affiliated with the Centre for Infectious Diseases and Microbiology Laboratory Services at Sydneys Westmead Hospital, according to the study.
While the exact source of the new H1N1 strain is a mystery, their research has raised many new questions, they said. The authors compared the genetic blueprints of flu strains stored in the free database Genbank and found the pandemic viruss nearest ancestors circulate in pigs.
Simplest Explanation
While migratory birds may have acted as conduit for their convergence, human involvement in bringing them together is by far the simplest explanation, Gibbs said in a telephone interview today.

Kate Story
11-25-2009, 06:11 PM
I live in Georgia approx. 45 miles from Madison where there is a roadside field that now holds over 500,000 plastic grave liners complete with lids. The CDC leased this land and it is reported that the liners were purchased by FEMA. I have lived in this same location for 25 years and this stockpile only began a few years ago. It is a bone chilling sight to say the least. From reports on the net these coffin stockpiles can now be found all over the nation. Someone is expecting or PLANNING something for millions of people.

Once you view the liners, you can continue on up toward Atlanta, home of the CDC, and stop at Elberton Ga. where the ghastly Illuminati Guidestones stand in the middle of a pasture. Whoever had those monuments constructed paid out millions as they are made of tons blue Georgia granite so I would hardly think it is a joke. Once you read the first 'commandment' on the stones you will get the message. I have a feeling all of what is happening now was planned to take place in the mid 80's but was hindered. Here are two very informative videos. Don't miss the second one.

http://video.google.com/videosearch?q=gun+control&hl=en&emb=#q=fema+coffins+in+georgia&hl=en&view=2&emb=0&qvid=fema+coffins+in+georgia&vid=3670060143879249963

http://video.google.com/videosearch?q=gun+control&hl=en&emb=#q=jack+brooks+and+oliver+north&hl=en&view=2&emb=0&qvid=jack+brooks+and+oliver+north&vid=5912390886871235156

Ed Jewett
12-02-2009, 07:26 AM
Tuesday, December 1, 2009

Public Menace-Private Profit: America's Biowarfare Alliance (http://antifascist-calling.blogspot.com/2009/12/public-menace-private-profit-americas.html)

In September, The New York Times reported (http://www.nytimes.com/2009/09/22/us/22chicago.html) that a University of Chicago researcher, Malcolm Casadaban, died after exposure to "a weakened and ordinarily harmless strain of the bacteria that cause plague."

According to the Times, "Dr. Casadaban, an associate professor at the university, was studying the bacteria to create a better vaccine for plague ... in part because of concerns about its possible use in bioterrorism." The Times averred that "infectious disease experts said researchers rarely die from being infected with an ordinarily harmless strain of the bacteria or viruses they are studying."

Which of course, raise inevitable and troubling questions: just how "safe" was the strain of plague studied by Casadaban, and was this research part of a new round of illicit, highly compartmented experiments meant to bulk-up America's first-strike arsenals?

While there is no evidence that Casadaban ever worked on banned weapons, indeed the molecular geneticist was a leading expert into the origins of bubonic plague, the casual agent responsible for the Black Death, and an opponent of biological warfare, what of his colleagues?

One expert, Dr. Kenneth Alexander, told the Times "there might have been something unusual about the bacteria that caused it to be dangerous, a mutation, for example." Alexander hastened to add that "it was more likely" that the researcher had a "pre-existing condition," one that "made him more susceptible to infection."

Perhaps. But according to Edmond Hammond, director of the now-defunct Sunshine Project (http://www.sunshine-project.org/), records pried from the federal government through the Freedom of Information Act uncovered a disturbing pattern of criminal neglect amongst university and corporate officials.

Hammond discovered, and shared with Congress (http://www.fas.org/irp/congress/2007_hr/germs.pdf) back in 2007, information that should have blown the lid off of one of America's dirtiest--and deadliest--little secrets. In excruciating detail, citing case after case, Hammond told congressional investigators that amongst the deadly pathogens that escaped containment in a series of underreported accidents were the following substances: Plague, anthrax, Rocky Mountain spotted fever, tularemia, brucellosis and Q fever.

Lab workers became sick, communities were threatened and yet, illicit work with these dangerous germs continue; just another day at the office for militarists, corporate grifters and their academic accomplices.

While Dr. Casadaban's death is a tragedy for family and friends, was a "pre-existing condition" responsible for the scientist's demise or was something more sinister taking place behind closed doors without his knowledge?

In the former Soviet Union, the Sunshine Project revealed that scientists involved in illegal offensive biowarfare research developed "plague bacteria (Yersinia pestis) ... that were resistant to 16 different antibiotics. Today, the genetic introduction of antibiotic resistance into bacterial pathogens is routine work in almost any microbiology laboratory."

While it is quite possible that Casadaban's death was a freak accident, nothing however can, or should, be ruled out.

Fanciful speculation? Better think again!

In June, Global Security Newswire reported (http://gsn.nti.org/gsn/nw_20090618_8179.php) that during a routine inventory at the U.S. Army Medical Research Institute of Infectious Diseases (USAMRIID) at Fort Detrick, Md., safety officers "found nearly 10,000 more vials of potentially lethal pathogens than were known to be stored at the site."

Claiming that there are "multiple layers of security," Ft. Detrick's deputy commander Col. Mark Kortepeter said it was "extremely unlikely" that any of the center's samples had been smuggled out. "Unlikely," but not impossible.

Amongst the 9,200 extra samples uncovered during the inventory were "bacterial agents that cause plague, anthrax and tularemia; Venezuelan, Eastern and Western equine encephalitis viruses; Rift valley fever virus; Junin virus; Ebola virus; and botulinum neurotoxins." In other words substances which can, and probably have, been weaponized by the Pentagon.

As Antifascist Calling previously reported (http://antifascist-calling.blogspot.com/2009/08/bringing-bio-war-home.html), with "biodefense" as a cover, the U.S. National Security State has spent tens of billions of dollars ($56.9 billion since 2001, according to the Center for Arms Control and Non-Proliferation (http://www.armscontrolcenter.org/policy/biochem/articles/fy09_biodefense_funding/)) on secretive programs investigating the deadliest pathogens known to nature, or ginning up new chimeric monsters in any number of privately-run labs.

The antinuclear watchdog group Tri-Valley CAREs (TVC (http://www.trivalleycares.org/)) obtained documents (http://trivalleycares.presstools.org/node/33429) under the Freedom of Information Act that revealed how Lawrence Livermore National Laboratory (LLNL (http://www.llnsllc.com/)), a "limited liability corporation" overseen by the University of California, Bechtel, BWX Technologies, Washington Group International and Battelle, routinely violated federal regulations and had carried out "restricted experiments" that resulted in the inadvertent release of anthrax in 2005.

Noting that "the relevant details of the 2005 anthrax accident were kept from the public at the time, just as happened with the illegal experiments that are coming to light today," TVC learned that this work is expanding, with little in the way of effective oversight by Congress or indeed, by any regulatory agency.

LLNL has now opened a Biosafety Level 3 (BSL-3) facility and is planning to experiment with pathogens exquisitely suited for use as offensive weapons. Activities contemplated include, "aerosolizing (spraying) pathogens such as plague, tularemia and Q fever, in addition to anthrax. Moreover, government documents disclose that planned experiments in the BSL-3 include genetic modification and potentially novel manipulation of viruses, prions and other agents."

In October, TVC filed a motion (http://trivalleycares.presstools.org/node/34324) for summary judgement in Federal Court in the Northern District of California "aiming to stop the operation of a bio-warfare agent research facility at the Lawrence Livermore National Lab (LLNL) main site in Livermore, California."

According to TVC, "the large inventory of multiple bio-weapon agents, the presence of genetically modified variants, and the fact that some of the pathogens have been put into just the right form to be effectively spread via an airborne release, all serve to make the Livermore BSL-3 a potential magnet for terrorism from either an internal or external source."

Currently, some 400 research facilities and more than 15,000 individuals are cleared "to have access to select agents, which include anthrax, smallpox and the Ebola virus," according to a September report (http://www.ncbi.nlm.nih.gov/bookshelf/picrender.fcgi?book=napp&part=nap12774&blobtype=pdf&blobtype=pdf) by the National Research Council.

The NRC averred that lax security at laboratories that work with select agents "pose a severe risk to human or animal health," risks that "have grown as the amount of research has increased in recent years."

And if one or more of these researchers should "go rogue," for money or as a plausibly deniable component of a Pentagon or CIA operation, doesn't the public have the right to expect the civilian side of government would weed out such miscreants from work with these deadly toxins?

A History of Illicit Research

The close proximity of U.S. biological warfare programs and the pharmaceutical industry is hardly an historical accident. From its inception, American research drew from a rich pool of biomedical researchers backed by the formidable technological resources of Big Pharma.

As Leonard Cole revealed in his 1988 expos, Clouds of Secrecy: The Army's Germ Warfare Tests over Populated Areas, biowarfare research during World War II and the Cold War period was a public/private affair in which the government provided funds to state agencies and private corporations alike in the hope that such solicitous relationships would lead to breakthroughs in the area of offensive weapons or what is now euphemistically called "biodefense."

Indeed, none other than George W. Merck, the president of the Merck Pharmaceutical Company, was a top-flight consultant to the Secretary of War. In that capacity, Merck and his company provided expertise and technological know-how for work on America's nascent biowar programs. In a 1946 report to the Secretary of War penned by Merck, Cole revealed that the program "included research, testing, development, and production of biological agents," all carried out as Merck wrote, in the "strictest secrecy."

While wartime fears of biological attacks by the Axis powers represented a clear and present danger to the United States and their allies as revelations of Nazi Germany and Imperial Japan's active programs attest, this information was scrupulously covered-up and suppressed for decades. Indeed after the war, the United States actively recruited these sociopaths into their biological, chemical and nuclear weapons programs.

As is now known, America's military establishment struck a devil's bargain with the same war criminals who, in the name of science, visited death upon millions. While the doctors and biologists who filled the ranks of Japan's Unit 731 hadn't achieved a "breakthrough" in terms of delivery systems' development, as researcher Sheldon H. Harris revealed in Factories of Death, they possessed an invaluable resource sought by U.S. bioweaponeers: detailed records of the Japanese Army's obscene human experiments.

After the war with a new official enemy looming on the horizon--the Soviet Union--Merck admonished the state to maintain a strong biological warfare program, writing: "Work in this field, born of the necessity of war, cannot be ignored in time of peace; it must be continued on a sufficient scale to provide an adequate defense."

By 1948, the newly-emerging national security state stood-up a Committee on Biological Warfare within the Department of Defense to do just that. Shortly thereafter, the Central Intelligence Agency, particularly the Company's Technical Services Division (TSD), so-called "wizards of Langley," ran a series of illicit programs that sought to "secure the realm" through the application of the latest advances in the biological and psychological sciences.

Over decades, projects such as Bluebird, Artichoke, MKDELTA, MKNAOMI and MKULTRA, variously identified by researchers as "mind control" projects--which they were--garnered outrage when it was revealed during the 1970s that the Agency conspired with leading psychiatrists, psychologists, medical doctors, biologists and academic institutions in funding obscene human experiments employing psychoactive drugs such as LSD, mescaline and BZ on unwitting test subjects.

As the Senate Select Committee on Intelligence Activities, popularly known as the Church Committee, revealed (http://www.druglibrary.org/schaffer/HISTORY/e1950/mkultra/AppendixA.htm) during hearings to examine the Watergate scandals of the 1970s, the Pentagon's own programs ran simultaneously with those of the CIA. The Committee discovered:

In many respects, the Army's testing programs duplicated research which had already been conducted by the CIA. They certainly involved the risks inherent in the early phases of drug testing. In the Army's tests, as with those of the CIA, individual rights were also subordinated to national security considerations; informed consent and followup examinations of subjects were neglected in efforts to maintain the secrecy of the tests. Finally, the command and control problems which were apparent in the CIA's programs are paralleled by a lack of clear authorization and supervision in the Army's programs. (Senate Select Committee on Intelligence Activities, Project MKULTRA, The CIA's Program of Research in Behavioral Modification, United States Senate, August 3, 1977, Appendix A, p. 92)While these projects may only have achieved modest success in standing up programmable assassins, as evidence on Lee Harvey Oswald and Sirhan Sirhan may suggest (http://www.ctka.net/pr598-rfk.html), MKULTRA and its spin-offs were primarily behavioral modification programs subsequently useful for what are now euphemistically termed "enhanced interrogation techniques," e.g., torture and as a formidable bioweapons project.

Indeed, Ft. Detrick's Special Operations Division (SOD), chock-a-block with CIA officers and assets, was, by the early 1950s experimenting with, and assembling biologically-based assassination weapons that were easily concealed and could be deployed by "wet work" specialists to murder foreign leaders such as the multiple failed plots against Fidel Castro, or Patrice Lumumba attest. As researcher Ed Regis documented, Congolese Prime Minister Lumumba was a thorn in the secret state's side.

Refusing to play ball with Washington so as to facilitate the extraction of that nation's vast mineral wealth by American multinational corporations, Lumumba sealed his fate when he sought military assistance from the Soviet Union. At that point, the national liberation leader became an object for Agency "executive action."

It was around this time that the CIA's Deputy Director for Plans, Richard Bissell, had a couple of informal talks with his scientific adviser, Sid Gottlieb, concerning the subject of the covert assassination of foreign leaders. Gottlieb suggested that biological agents were perfect for the task: they were invisible, untraceable, and, if intelligently selected and delivered, not even liable to create a suspicion of foul play. The target would get sick and die exactly as if he'd been attacked by a natural outbreak of an endemic disease. Plenty of lethal or incapacitating germs were out there and available, Gottlieb told Bissell, and they were easily accessible to the CIA. (Ed Regis, The Biology of Doom, New York: Henry Holt and Company, 1999, pp. 182-183)While proponents of continued research with nature's deadliest pathogens argue that the Biological Weapons Convention (BWC) allows for purely "defensive" work to protect the public against potential bioattacks, this mendacious logic studiously avoids the issue of the dual-use nature of this work.

Cole unearthed documents, including a 1968 official history of Ft. Detrick penned by a Pentagon bioweaponeer who asserted forthrightly that "research and development in the offensive aspects of BW proceeded hand in hand with defensive developments for, in truth, the two are almost inseparable."

But MKULTRA and its grisly spin-offs are a thing of the past, right? Not by a long shot!

Jeffrey Kaye, a psychologist and critic of the torture-enabling American Psychological Association (APA), revealed (http://pubrecord.org/torture/6122/investigate-ciarandapa-torture/) November 23, that the group had organized a workshop in 2007 at the Arlington, Virginia headquarters of the dodgy RAND Corporation.

That conference, entitled "Science of Deception: Integration of Practice and Theory (http://www.apa.org/ppo/spin/703.html)," discussed new and novel ways "to utilize drugs and sensory bombardment techniques to break down interrogatees. Those are signal techniques of psychological torture long utilized by the CIA and other intelligence agencies and military around the world."

Citing APA documents, Kaye discovered that APA and their friends at CIA were actively looking for "pharmacological agents ... known to affect apparent truth-telling behavior." Kaye learned that amongst the probative questions driving the spooks and contractors was this revealing sentence: "What are sensory overloads on the maintenance of deceptive behaviors? How might we overload the system or overwhelm the senses and see how it affects deceptive behaviors?"

According to numerous researchers, the CIA, and the psychologists and psychiatrists they contracted to work with them, including many of the top behavioral scientists of their day, experimented with many drugs in their quest to find a truth drug that would open up the recalcitrant and expose the liar and the dissembler. The CIA has declassified a paper from its in-house intelligence journal from the early 1960s, "'Truth' Drugs in Interrogation (https://www.cia.gov/library/center-for-the-study-of-intelligence/kent-csi/vol5no2/html/v05i2a09p_0001.htm)," where they discuss research on drugs for interrogation ranging from scopolamine, amphetamines, and barbiturates to cannabis, LSD, and mescaline. The CIA authors discuss the limitations of using drugs, based on research, and conclude that a special use for drugs may be found in detection of deception. (Jeffrey Kaye, "Who Will Investigate CIA/RAND/APA Torture 'Workshop'?," The Public Record, November 21, 2009)What was true throughout the Cold War period is just as true today and remains a pressing public health issue. As Global Security Newswire reported (http://gsn.nti.org/gsn/nw_20090827_4632.php) in August, the U.S. Army Medical Research Institute of Infectious Diseases (USAMRIID) began construction on a new facility at Ft. Detrick in Frederick, Maryland. The brief report states that "new site will allow for more study of lethal diseases and should have space for 952 staffers, compared to the 800 now using facilities that date back four to five decades."

While the National Academy of Sciences "plans to assess health and safety issues raised by observers who believe there has been insufficient consideration regarding the potential release of an infectious agent from the facility," the same can also be said for the BSL-3 and BSL-4 facilities in private hands, under contract to the U.S. government.

As I reported (http://antifascist-calling.blogspot.com/2009/08/bringing-bio-war-home.html) in "Bringing the (Bio) War Home," the Bulletin of the Atomic Scientists revealed (http://www.thebulletin.org/web-edition/columnists/laura-h-kahn/biosecurity-lessons-the-bruce-ivins-case) that "massive U.S. biodefense spending and a buildup of high-containment laboratories throughout the country might have created an internal security risk that no outside terrorist group could ever duplicate. Nearly two dozen new federal and many more new private biosafety level 3 and 4 laboratories have been built in recent years, meaning a large cadre of scientists has access to extraordinarily lethal material."

And if today's bioweaponeers have their way, such risks will increase exponentially with untold consequences for us all.

Building Banned Weapons

Leading experts (http://www.globalsecurity.org/org/nsn/nsn-060331.htm), as I reported (http://antifascist-calling.blogspot.com/2009/08/dark-winter-for-public-health-meet.html) in August, have derided the possibility that terrorist groups have the know-how to fabricate smallpox or other pathogens into biological weapons as a massive "fraud ... and a substantial one" perpetrated on the American people.

Hysterical claims by securocrats that "bioterrorism is one of the most pressing problems we have on the planet today," an assertion made by Dr. Tara O'Toole, the Undersecretary of Science and Technology at the Department of Homeland Security, is not borne out by the facts.

Indeed, such claims not only distort available evidence that terrorist groups have such capabilities but conceal the more salient fact that Pentagon weaponeers continue to build banned weapons.

According to Jeanne Guillemin, author of Biological Weapons: From the Invention of State-Sponsored Programs to Contemporary Bioterrorism, the Pentagon and CIA made and tested a model of a Soviet anthrax bomb and created an antibiotic-resistant strain of anthrax.

After consulting with scientists who strongly suggested that the CIA anthrax bomb project would violate the BWC, "CIA lawyers decided the project was within the allowed realm of defensive research," Guillemin revealed.


Project Clear Vision, a joint investigation by the CIA and the Battelle Memorial Institute, under contract to the Agency, reconstructed and tested a Soviet-era anthrax bomblet in order to test its dissemination characteristics. The Agency "decided the same" for the small, fully functional bioweapons facility built under the rubric of Project Bacchus.

The third initiative, Project Jefferson, led to the development of an antibiotic-resistant strain of anthrax based on a Soviet model. After the outgoing Clinton administration hesitated to give the CIA the go-ahead for the project, the Bush regime's National Security Council gave the Pentagon permission. "They believed" Guillemin wrote, "the Pentagon had the right to investigate genetically altered pathogens in the name of biodefense, 'to save American lives'."

Shortly thereafter, the Pentagon authorized the Defense Intelligence Agency (DIA), one of the most secretive and heavily-outsourced Defense Department branches, to re-create the deadly anthrax strain.

Commenting on the close proximity of the 2001 anthrax provocation and the rush towards the invasion and occupation of Iraq, constitutional law expert Glenn Greenwald writes (http://www.salon.com/news/opinion/glenn_greenwald/index.html?story=/opinion/greenwald/2009/11/27/anthrax) that the anthrax attack "played at least as large of a role as the 9/11 attack itself, if not larger, in creating the general climate of fear that prevailed for years in the U.S. and specifically how the anthrax episode was exploited by leading media and political figures to gin up intense hostility towards Iraq."

Which is why, according to Greenwald, "it's so striking how we've collectively flushed this terrorist attack down the memory hole as though it doesn't exist." Indeed, "what makes this particularly significant is that the anthrax attack is unresolved and uninvestigated."

Here we have one of the most consequential political events of the last decade at least--a lethal biological terrorist attack aimed at key U.S. Senators and media figures, which even the FBI claims originated from a U.S. military lab. The then-British Ambassador to the U.S. is now testifying what has long been clear: that this episode played a huge role in enabling the attack on Iraq. Even our leading mainstream, establishment-serving media outlets--and countless bio-weapons experts--believe that we do not have real answers about who perpetrated this attack and how. And there is little apparent interest in investigating in order to find out. Evidently, this is just another one of those things that we'll relegate to "the irrelevant past," and therefore deem it unworthy of attention from our future-gazing, always-distracted minds. (Glenn Greenwald, "A key British official reminds us of the forgotten anthrax attack," Salon, November 27, 2009)On and on it goes, America's headlong rush into the abyss.

While the American people believed the election of Barack Obama signaled a change in direction from decades' long policies that have brought the planet to the brink of disaster, those hopes are little more than cynical illusions manufactured by media specialists and spin-doctors, the ubiquitous army of "message force multipliers" who do the bidding of their corporatist masters.

After all, $57 billion buys much in the way of silence.



Posted by Antifascist at 5:14 PM (http://antifascist-calling.blogspot.com/2009/12/public-menace-private-profit-americas.html)

Magda Hassan
12-19-2009, 03:10 AM
WHO Swine Flu Pope under investigation for gross conflict of interest
By F. William Engdahl
Online Journal Contributing Writer


Dec 15, 2009, 00:22


The man with the nickname Dr Flu, Professor Albert Osterhaus, of the Erasmus University in Rotterdam, Holland, has been named by Dutch media researchers as the person at the center of the worldwide Swine Flu H1N1 Influenza A 2009 pandemic hysteria. Not only is Osterhaus the connecting person in an international network that has been described as the Pharma Mafia, he is THE key advisor to WHO on influenza and is intimately positioned to personally profit from the billions of euros in vaccines allegedly aimed at H1N1.
Earlier this year the Second Chamber of the Netherlands Parliament undertook an investigation into alleged conflicts of interest and financial improprieties of the well-known Dr. Osterhaus. Outside of Holland and the Dutch media, the only note of the sensational investigation into Osterhaus business affairs came in a tiny note in the respected British magazine, Science.
Osterhauss credentials and expertise in his field were not in question. What is in question, according to a short report published by the journal Science, are his links to corporate interests that stand to potentially profit from the swine flu pandemic. Science carried the following brief note in its October 16 2009 issue about Osterhaus:
For the past 6 months, one could barely switch on the television in the Netherlands without seeing the face of famed virus hunter Albert Osterhaus talking about the swine flu pandemic. Or so it has seemed. Osterhaus, who runs an internationally renowned virus lab at Erasmus Medical Center, has been Mr. Flu. But last week, his reputation took a nosedive after it was alleged that he has been stoking pandemic fears to promote his own business interests in vaccine development. Last week, his reputation took a nosedive after it was alleged that he has been stoking pandemic fears to promote his own business interests in vaccine development. As Science went to press, the Dutch House of Representatives had even slated an emergency debate about the matter. [1]
On November 3, 2009, it appeared that Osterhaus emerged with at least the damage somewhat under control. An updated Science blog noted, The House of Representatives of the Netherlands today rejected a motion asking the government to sever all ties with virologist Albert Osterhaus of Erasmus Medical Center in Rotterdam, who had been accused of conflicts of interest in his role as a government adviser. But Dutch health minister Ab Klink, meanwhile, announced a Sunshine Act compelling scientists to disclose their financial ties to companies. [2]
The Minister, Ab Klink, reportedly a personal friend of Osterhaus, [3] subsequently issued a statement on the ministrys website, claiming that Osterhaus was but one of many scientific advisers to the ministry on vaccines for H1N1, and that the Ministry knew about the financial interests of Osterhaus. [4] Nothing out of the ordinary, merely pursuit of science and public health, so it seemed.
More careful investigation into the Osterhaus Affair suggests that the world-renowned Dutch Virologist may be at the very center of a multi-billion Euro pandemic fraud which has used human beings in effect as human guinea pigs with untested vaccines and in cases now emerging, resulting in deaths or severe bodily paralysis or injury.
The Bird Shit Hoax
Albert Osterhaus is no small fish. He stands at the global nexus of every major virus panic of the past decade from the mysterious SARS deaths in Hong Kong, where current WHO Director Margaret Chan got her start in her career as a local health official. According to his official bio at the European Commission, Osterhaus was engaged in April 2003, at the height of the panic over SARS (Severe Acquired Respiratory Syndrome) in investigation of the Hong Kong outbreak of respiratory illnesses. The EU report states, he again showed his skill at moving fast to tackle a serious problem. Within three weeks he had proved that the disease was caused by a newly discovered coronavirus that resides in civet cats, other carnivorous animals or bats. [5]
Then Osterhaus moved on as SARS cases vanished from view, this time publicizing dangers of what he claimed was H5N1 Avian Flu. In 1997 he had already began sounding the alarm following the death in Hong Kong of a three-year-old who Osterhaus learned had had direct contact with birds. Osterhaus went into high gear lobbying across Holland and Europe claiming that a deadly new mutation of avian flu had jumped to humans and that drastic measures were required. He claimed to be the first scientist in the world to show that H5N1 could be transferred into humans. [6]
In a BBC interview in October 2005 on the danger of Avian Flu, Osterhaus declared, . . . if the virus manages indeed to, to mutate itself in such a way that it can transmit from human to human, then we have a completely different situation, we might be at the start of the pandemic. He added, there is a real chance that this virus could be trafficked by the birds all the way to Europe. There is a real risk, but nobody can estimate the risk at this moment, because we havent done the experiments. [7] It never did manage to mutate, but he was ready to do the experiments, presumably for a hefty fee.
To bolster his frightening pandemic scenario, Osterhaus and his lab assistants in Rotterdam began assiduously assembling and freezing samples of, well, bird shit, in an attempt to build a more scientific argument. He claimed that at certain times of the year up to 30 percent of all European birds acted as carriers of the deadly avian virus, H5N1. He also claimed that farmers working with hens and chickens were then exposed. Osterhaus briefed journalists who dutifully noted his alarm. Politicians were alerted. He wrote papers proposing that the far away deaths in Asia from what he termed H5N1 were coming to Europe, presumably on the wings or in the innards of deadly sick infected birds. He claimed that migratory birds were carrying the deadly new disease as far west as Rgen and Ukraine. [8] He conveniently ignored the fact that birds do not migrate east to west but rather north to south.
Osterhaus Avian Flu alarm campaign really took off in 2003 when a Dutch veterinary doctor became ill and died. Osterhaus claimed the death was from H5N1. He convinced the Dutch government to order slaughter of millions of chickens. Yet no other infected persons died from the alleged H5N1. Osterhaus claimed that that was simply proof of the effectiveness of the preemptive slaughter campaign. [9]
Osterhaus claimed that bird feces were the source, via air bombardment or droppings, onto populations and birds below. That was the vehicle for the spread of the deadly new Asian strain of H5N1 he insisted.
There was only one problem with the now voluminous frozen samples of diverse bird excrement he and his associated had collected and frozen at his institute. There was not one single confirmed example of H5N1 virus found in any of his samples. At a May 2006 Congress of the World Organization for Animal Health (OIE), Osterhaus and his Erasmus colleagues were forced to admit that in testing 100,000 samples of their assiduously saved bird feces, they had discovered not one single case of H5N1 virus. [10]
At a WHO conference in Verona in 2008 titled Avian influenza at the Human-Animal Interface, in a presentation to scientific colleagues undoubtedly less impressed by appeals to pandemic emotion than the non-scientific public, Osterhaus admitted that A proper risk assessment of H5N1 as the cause of a new pandemic cannot be made with the currently available information. [11] By then, however, his sights were already firmly on other possible pandemic triggers to focus his vaccination activities.
Swine Flu and WHO corruption
When no mass wave of human deaths from Avian Flu materialized and after Roche, maker of Tamiflu and GlaxoSmithKline had banked billions of dollars in profits from worldwide government stockpiling of their dangerous and reportedly ineffective antiviral drugs, Tamiflu by Roche, and Relenza by GlaxoSmithKline, Osterhaus and other WHO advisers turned to other greener pastures.
By April 2009 their search seemed rewarded as La Gloria, a small Mexican village in Veracruz, reported a case of a small child ill with what had been diagnosed as Swine Flu or H1N1. With indecent haste, the propaganda apparatus of the World Health Organization in Geneva went into gear, with statements from the director-general Dr Margaret Chan, about a possible danger of a global pandemic.
Chan made such irresponsible statements as declaring a public health emergency of international concern. [12] The further cases of outbreak at La Gloria Mexico were reported on one medical website as, a strange outbreak of acute respiratory infection, which led to bronchial pneumonia in some pediatric cases. According to a local resident, symptoms included fever, severe cough, and large amounts of phlegm. [13]
Notably those were symptoms which would make sense in terms of the proximity of one of the worlds largest pig industrial feeding concentrations at La Gloria owned by Smithfield Farms of the USA. Residents had picketed the Smithfield Farms site in Mexico for months complaining of severe respiratory problems from the fecal waste lagoons. That possible cause of the diseases in La Gloria apparently did not interest Osterhaus and his colleagues advising the WHO. The long-awaited pandemic that Osterhaus had predicted ever since his involvement with SARS in the Guandgong Province of China in 2003, was now finally at hand.
On June 11, 2009 Margaret Chan of WHO made the declaration of a Phase 6 Pandemic Emergency regarding the spread of H1N1 Influenza. Curiously in announcing it, she noted, On present evidence, the overwhelming majority of patients experience mild symptoms and make a rapid and full recovery, often in the absence of any form of medical treatment. She then added, Worldwide, the number of deaths is small . . . we do not expect to see a sudden and dramatic jump in the number of severe or fatal infections.
It later was learned that Chan acted, following heated debates inside WHO, on the advice of the scientific advisory group of WHO, or SAGE, the Strategic Advisory Group of Experts. One of the members of SAGE at the time and today was Dr. Albert Mr Flu Osterhaus.
Not only was Osterhaus in a key position to advocate the panic-inducing WHO Pandemic emergency declaration. He was also chairman of the leading private European Scientific Working group on Influenza (ESWI), which describes itself as a multidisciplinary group of key opinion leaders in influenza [that] aims to combat the impact of epidemic and pandemic influenza. Osterhaus ESWI is the vital link as they themselves describe it, between the World Health Organization (WHO) in Geneva, the Robert Koch Institute in Berlin and the University of Connecticut, USA.
What is more significant about the ESWI is that its work is entirely financed by the same pharma mafia companies that make billions on the pandemic emergency as governments around the world are compelled to buy and stockpile vaccines on declaration of a WHO Pandemic. The funders of ESWI include H1N1 vaccine maker Novartis, Tamiflu distributor, Hofmann-La Roche, Baxter Vaccines, MedImmune, GlaxoSmithKline, Sanofi Pasteur and others.
Not to lose the point, the world-leading virologist, official adviser on H1N1 to the governments of the UK and Holland, Dr Albert Osterhaus, head of the Department of Virology at the Erasmus Medical College of Rotterdam, also sat on the WHOs elite SAGE and served as chairman at the same time of the pharma industry-sponsored ESWI, which in turn urged dramatic steps to vaccinate the world against the grave danger of a new Pandemic they insisted could rival the feared 1918 Spanish Flu pandemic.
The Wall Street bank, JP Morgan, estimated that in large part as a result of the WHO pandemic decision, the giant pharma firms that also finance Osterhaus ESWI work, stand to reap some 7.5 to 10 billion in profits. [14]
A fellow member of WHOs SAGE is Dr Frederick Hayden, of Britains Wellcome Trust and reportedly a close friend of Osterhaus. Hayden also receives money for advisory services from Roche and GlaxoSmithKline among other pharma giants involved in producing products related to the H1N1 panic.
Chairman of WHOs SAGE is another British scientist, Prof. David Salisbury of the UK Department of Health. He also heads the WHO H1N1 Advisory Group. Salisbury is a robust defender of the pharma industry. He has been accused by UK health citizen health group One Click of covering up the proven links between vaccines and an explosive rise in infant autism as well as links between the vaccine Gardasil and palsy and even death. [15]
Then on September 28, 2009 the same Salisbury stated, There is a very clear view in the scientific community that there is no risk from the inclusion of Thiomersal. The vaccine being used for H1N1 in Britain is primarily produced by GlaxoSmithKlilne. It contains the mercury preservative Thiomersol. Because of growing evidence that Thiomersol in vaccines might be related to autism in children in the United States, in 1999 the American Academy of Pediatrics and the US Public Health Service called for it to be removed from vaccines. [16]
Yet another SAGE member at WHO with intimate financial ties to the vaccine makers that benefit from SAGEs recommendations to WHO is Dr. Arnold Monto, a paid consultant to vaccine maker MedImmune, Glaxo and ViroPharma.
Even more, the meetings of the independent scientists of SAGE are attended by observers who include, yes, the very vaccine producers GlaxoSmithKline, Novartis, Baxter and company. One might ask if the SAGE are supposed to be the worlds leading experts on flu and vaccines, why they would ask the vaccine makers to sit in.
In the past decade the WHO, in order to boost funds at its disposal entered into what it calls public private partnerships. Instead of receiving its funds solely from member United Nations governments as its original purpose had been, WHO today receives almost double its normal UN budget in the form of grants and financial support from private industry. The industry? The very drug and vaccine makers who benefit from decisions like the June 2009 H1N1 Pandemic emergency declaration. As the main financiers of the WHO bureaucracy, naturally the Pharma Mafia and their friends receive what has been called open door red carpet treatment in Geneva. [17]
In an interview with Der Spiegel magazine in Germany, epidemiologist Dr. Tom Jefferson of the Cochrane Collaboration, an organization of independent scientists evaluating all flu related studies, noted the implications of the privatization of WHO and the commercialization of health:
. . . one of the extraordinary features of this influenza -- and the whole influenza saga -- is that there are some people who make predictions year after year, and they get worse and worse. None of them so far have come about, and these people are still there making these predictions. For example, what happened with the bird flu, which was supposed to kill us all? Nothing. But that doesnt stop these people from always making their predictions. Sometimes you get the feeling that there is a whole industry almost waiting for a pandemic to occur.
SPIEGEL: Who do you mean? The World Health Organization (WHO)?
Jefferson: The WHO and public health officials, virologists and the pharmaceutical companies. Theyve built this machine around the impending pandemic. And theres a lot of money involved, and influence, and careers, and entire institutions! And all it took was one of these influenza viruses to mutate to start the machine grinding . . . [18]
When asked if the WHO had deliberately declared the Pandemic Emergency in order to create a huge market for H1N1 vaccines and drugs, Jefferson replied,
Dont you think theres something noteworthy about the fact that the WHO has changed its definition of pandemic? The old definition was a new virus, which went around quickly, for which you didnt have immunity, and which created a high morbidity and mortality rate. Now the last two have been dropped, and thats how swine flu has been categorized as a pandemic. [19]
Conveniently enough, the WHO published the new Pandemic definition in April 2009 just in time to allow WHO, on advice of SAGE and others like Albert Dr Flu Osterhaus and David Salisbury, to declare the mild cases of flu dubbed H1N1 Influenza A to be declared Pandemic Emergency. [20]
In a relevant footnote, the Washington Post on December 8 in an article on the severity, or lack of same, of the world H1N1 pandemic reported that, with the second wave of H1N1 infections having crested in the United States, leading epidemiologists are predicting that the pandemic could end up ranking as the mildest since modern medicine began documenting influenza outbreaks. [21]
Russian Parliamentarian and chairman of the Duma Health Committee, Igor Barinow has called on the Russian Representative to WHO in Geneva to order an official investigation into the growing evidence of massive corruption of the WHO by the pharmaceutical industry. There are grave accusations of corruption within the WHO, said Barinow. An international commission of inquiry is urgently required. [22]
Notes
1. Martin Enserink, In Holland, the Public Face of Flu Takes a Hit, Science, 16 October 2009: Vol. 326. no. 5951, pp. 350 351; DOI: 10.1126/science.326_350b.
2. Science, November 3, 2009, Roundup 11/3 The Brink Edition (http://images.google.com/imgres?imgurl=http://blogs.sciencemag.org/scienceinsider/panay.jpg&imgrefurl=http://blogs.sciencemag.org/scienceinsider/2009/11/roundup-113-the.html&usg=___pt_M2p5uuWJw2outvX-U8SbR9E=&h=168&w=250&sz=21&hl=en&start=3&tbnid=MnfYxYJ9Q).
3. Article from Dutch, De Farma maffia Deel 1 Osterhaus BV (http://images.google.com/imgres?imgurl=http://blogs.sciencemag.org/scienceinsider/panay.jpg&imgrefurl=http://blogs.sciencemag.org/scienceinsider/2009/11/roundup-113-the.html&usg=___pt_M2p5uuWJw2outvX-U8SbR9E=&h=168&w=250&sz=21&hl=en&start=3&tbnid=MnfYxYJ9Q), 28 November 2009.
4. Ministerie van Volksgezondheid, Welzijn en Sport, Financile belangen Osterhaus waren bekend Nieuwsbericht (http://www.minvws.nl/nieuwsberichten/pg/2009/osterhaus.asp), 30 september 2009.
5. European Commission, Research (http://ec.europa.eu/research/profiles/index_en.cfm?p=1_osterhaus), Dr Albert Osterhaus.
6. Ibid.
7. Jane Corbin, Interview with Dr Albert Osterhaus, BBC Panorama, 4 October, 2005.
8. Karin Steinberger, Vogelgrippe: Der Mann mit der Vogelperspektive (http://www.seuddeutsche.depanorama/8/373818/text/), Seuddeutsche Zeitung, 20 October, 2005.
9. Ibid.
10. SchweinegrippeGeldgieriger Psychopath Auslser der Pandemie? (http://polskaweb.eu/vater-der-neuen-grippen-wahrscheinlich-wahnsinnig-673756422645.html).
11. Ab Osterhaus, External factors influencing H5N1 mutation/reassortment events with pandemic potential (http://www.oie.int/eng/info_ev/en_verone.htm), OIE, 7-9 October 2008, Verona, Italy.
12. WHO Health Advisory (http://www.swine-flu-vaccine.info/), April 2009.
13. Biosurveillance,Swine Flu in Mexico- Timeline of Events (http://biosurveillance.typepad.com/biosurveillance/2009/04/swine-flu-in-mexico-timeline-of-events.html), April 24, 2009.
14. Cited in Louise Voller, Kristian Villesen, Strk lobbyisme bag WHO-beslutning om massevaccination (http://www.information.dk/215355), Information, Copenhagen, 15 November 2009.
15. Jane Bryant, et al, The One Click Group Response: Prof. David Salisbury Threatens Legal Action (http://www.theoneclickgroup.co.uk/documents/vaccines/David%20Salisbury%20Threatens%20One%20Click.pdf), 4 March, 2009.
16. Prof. David Salisbury cited in, Swine flu vaccine to contain axed additive (http://www.gulf-times.com/site/topics/printArticle.asp?cu_no=2&item_no=316888&version=1&template_id=38&parent_id=20), London Evening Standard, 28 September 2009.
17. Bert Ehgartner, Schwindel mit der Schweinegrippe Ist die Aufregung ein Coup der Pharmaindustrie? (http://www.profil.at/articles/0944/560/254615/schwindel-schweinegrippe-ist-aufregung-coup-pharmaindustrie)
18. Tom Jefferson, Interview with Epidemiologist Tom Jefferson: A Whole Industry Is Waiting For A Pandemic (http://www.spiegel.de/international/world/0,1518,637119,00.html) Der Spiegel, 21 July 2009.
19. Ibid.
20. Louise Voller, Kristian Villesen, Mystisk ndring af WHOs definition af en pandemi (http://www.information.dk/215341), Copenhagen Information, 15 November 2009.
21. Rob Stein, Flu Pandemic Could Be Mild, Washington Post, December 8, 2009.
22. Polskanet, Russland fordert internationale Untersuchung (http://polskaweb.eu/vater-der-neuen-grippen-wahrscheinlich-wahnsinnig-673756422645.html), 5 December 2009.
F. William Engdahl is author of A Century of War: Anglo-American Oil Politics and the New World Order (Pluto Press), and Seeds of Destruction: The Hidden Agenda of Genetic Manipulation (www.globalresearch.ca (http://www.globalresearch.ca/)). His latest book is Full Spectrum Dominance: Totalitarian Democracy in the New World Order (Third Millennium Press). He may be reached via his website, www.engdahl.oilgeopolitics.net (http://www.engdahl.oilgeopolitics.net/).
http://onlinejournal.com/artman/publish/article_5377.shtml

Ed Jewett
12-19-2009, 11:32 AM
Well, isn't that interesting? Thanks, Magda. I should send this to the people who hired me to create that virtual tabletop exercise... :idea::call2::argh:

Jan Klimkowski
12-19-2009, 12:11 PM
Magda, yes - thank you for posting that pretty devastating expose.

Here's another one (originally posted elsewhere) suggesting that, not only is the pandemic risk hyped, but that the "cure" is far from proven:


New doubts over Tamiflu
Updated on 08 December 2009
By Channel 4 News

The claim was that Tamiflu could reduce the hospitalising of patients with swine flu by up to 60 per cent. But Channel 4 News can reveal that a key paper upon which this claim was based is being questioned. Email us your experiences of Tamiflu at news@channel4.com.


Scientists attempting to peer review the paper requested vital data, and did not get it. Tonight we report a key plank of the evidence forTamiflu's effectiveness is being called into question.

As swine flu hit the UK, the anti-viral drug Tamiflu hit the headlines, becoming the de facto first line of defence against the epidemic.

It was lauded for reducing the length and duration of flu like illnesses and, importantly, for reducing hospitalisations.

Governments around the world stockpiled supplies. In the UK alone the estimated bill for Tamiflu is approaching half a billion.

Tonight Channel 4 News can reveal that serious scientific questions are being raised over the evidence base for Tamiflu.

Scientists we have spoken to say they have been unable to judge and properly test some of the claims made about the antiviral by its makers, Roche.

Claims about the the drug's effectiveness in reducing hospitalisations have been a key factor in decisions by governments around the world to stockpile Tamiflu (oseltamivir), to defend their citizens against a global pandemic.

Manufacturer Roche estimates that sales of Tamiflu this year will reach 1.6bn. The UK government has yet to say exactly how much money it has spent so far - but the unconfirmed figure suggests it could be as much as 500m.

Tamiflu's benefits are well publicised. Advocates say it reduces the chance of flu being transmitted in the first place, and that once someone has become infected it shortens the duration of the illness. Today's review confirms these findings.

But the drug is also credited with reducing complications and hospitalisations in those who develop full-blown flu. In a recent interview Roche Pharmaceuticals CEO William Burns said: "What Tamiflu can do is actually reduce hospitalisations by more than 60 per cent, which is really important if we are in the midst of a major pandemic."

This is the claim now under scrutiny. An investigation by Channel 4 News and the British Medical Journal (BMJ) has discovered that an independent team of scientists has been unable to verify the scientific evidence-base to support it.

The review, commissioned in July by the NHS and published today at BMJ.com, was conducted by the Cochrane Collaboration - a worldwide group of scientists and researchers that reviews medical research. They are internationally recognised for their work.

Speaking on Chanenl 4 News, Dr Tom Jefferson, one of the Cochrane reviewers said: "This is not just any drug, this is a public health drug which is recommended by governments... and the World Health Organisation - and has been recommended for some years."

Much of the Cochrane team's work has looked at the leading piece of clinical research supporting claims that Tamiflu reduces hospitalisations. This research was authored by swiss scientist Professor Laurent Kaiser.


His research, based on 10 clinical trials set up by Roche found that Tamiflu reduced by 59 per cent the number of people with flu who ended up in hospital. Roche have repeatedly referred to Professor Kaiser's paper when talking about Tamiflu's ability to reduce hospitalisations.

The study released today acknowledges that Tamiflu has a modest effect in reducing symptoms and duration of illness in otherwise healthy adults by about one day, but says there is insufficient published data to independently confirm its effects on reducing complications leading to hospitalisations .


When the Cochrane reviewers approached Professor Kaiser for the original data in order to verify his conclusions, he said he didn't have it and referred them to Roche. However, following detailed communication with the company, Roche did not supply the Cochrane team with the complete data they had requested and they were unable to verify the paper's findings.

Because they were unable to independently verify this data, the Cochrane review disregarded Kaisers paper from their analysis of the scientific evidence base supporting Tamiflus effectiveness in reducing complications. This removes a key plank of evidence supporting a claim repeatedly made by Roche and governments like ours.


And without this study, the reviewers came to a stark conclusion. Dr Jefferson told Channel 4 News: "We didn't find any convincing evidence that Tamiflu affects complications such as as hospitalisations and chest infections."

Dr Fiona Godlee, editor-in-chief of the BMJ, says this leaves important questions about effectiveness unresolved.


She said: "I think we're now in a situation where the evidence base for Tamiflu is far from compelling. Really, government needs to get to grips with this and to understand the truth around the evidence, given that this is a drug on which vast sums of public money have been spent."

But Roche stand by the paper saying that the study reports on which the paper was based had been shared with regulatory authorities worldwide. A spokesman for Roche said: "I think the figure of around 60 per cent reduction in complications, that came from this - the analysis of that was robust".

Roche also put forward a number of observational studies which they say support the effectiveness of Tamiflu in reducing complications.

Channel 4 News and the BMJ asked Professor Nick Freemantle and Dr Melanie Calvert, from the University of Birmingham, to review these observational studies. They concluded: "Oseltamivir may reduce the risk of pneumonia in otherwise healthy people who contract flu. However, the absolute benefit is small, and side effects and safety should also be considered.

Professor Freemantle added: "There is very little evidence to support the widespread use of oseltamivir in the otherwise healthy population who are developing signs of influenza like illness."

Dr Fiona Godlee and Professor Mike Clarke, Director of the UK Cochrane Centre, say this updated review is important because it calls into question not only the effectiveness of Tamiflu but "the whole system by which drugs are evaluated, regulated and promoted".

http://www.channel4.com/news/articles/science_technology/new+doubts+over+tamiflu/3454737

http://www.deeppoliticsforum.com/forums/showthread.php?t=2756

Peter Lemkin
12-19-2009, 02:41 PM
Tuesday, December 1, 2009

Public Menace-Private Profit: America's Biowarfare Alliance (http://antifascist-calling.blogspot.com/2009/12/public-menace-private-profit-americas.html)

In September, The New York Times reported (http://www.nytimes.com/2009/09/22/us/22chicago.html) that a University of Chicago researcher, Malcolm Casadaban, died after exposure to "a weakened and ordinarily harmless strain of the bacteria that cause plague."

According to the Times, "Dr. Casadaban, an associate professor at the university, was studying the bacteria to create a better vaccine for plague ... in part because of concerns about its possible use in bioterrorism." The Times averred that "infectious disease experts said researchers rarely die from being infected with an ordinarily harmless strain of the bacteria or viruses they are studying."

Which of course, raise inevitable and troubling questions: just how "safe" was the strain of plague studied by Casadaban, and was this research part of a new round of illicit, highly compartmented experiments meant to bulk-up America's first-strike arsenals?

While there is no evidence that Casadaban ever worked on banned weapons, indeed the molecular geneticist was a leading expert into the origins of bubonic plague, the casual agent responsible for the Black Death, and an opponent of biological warfare, what of his colleagues?

One expert, Dr. Kenneth Alexander, told the Times "there might have been something unusual about the bacteria that caused it to be dangerous, a mutation, for example." Alexander hastened to add that "it was more likely" that the researcher had a "pre-existing condition," one that "made him more susceptible to infection."

Perhaps. But according to Edmond Hammond, director of the now-defunct Sunshine Project (http://www.sunshine-project.org/), records pried from the federal government through the Freedom of Information Act uncovered a disturbing pattern of criminal neglect amongst university and corporate officials.

Hammond discovered, and shared with Congress (http://www.fas.org/irp/congress/2007_hr/germs.pdf) back in 2007, information that should have blown the lid off of one of America's dirtiest--and deadliest--little secrets. In excruciating detail, citing case after case, Hammond told congressional investigators that amongst the deadly pathogens that escaped containment in a series of underreported accidents were the following substances: Plague, anthrax, Rocky Mountain spotted fever, tularemia, brucellosis and Q fever.

Lab workers became sick, communities were threatened and yet, illicit work with these dangerous germs continue; just another day at the office for militarists, corporate grifters and their academic accomplices.

While Dr. Casadaban's death is a tragedy for family and friends, was a "pre-existing condition" responsible for the scientist's demise or was something more sinister taking place behind closed doors without his knowledge?

In the former Soviet Union, the Sunshine Project revealed that scientists involved in illegal offensive biowarfare research developed "plague bacteria (Yersinia pestis) ... that were resistant to 16 different antibiotics. Today, the genetic introduction of antibiotic resistance into bacterial pathogens is routine work in almost any microbiology laboratory."

While it is quite possible that Casadaban's death was a freak accident, nothing however can, or should, be ruled out.

Fanciful speculation? Better think again!

In June, Global Security Newswire reported (http://gsn.nti.org/gsn/nw_20090618_8179.php) that during a routine inventory at the U.S. Army Medical Research Institute of Infectious Diseases (USAMRIID) at Fort Detrick, Md., safety officers "found nearly 10,000 more vials of potentially lethal pathogens than were known to be stored at the site."

Claiming that there are "multiple layers of security," Ft. Detrick's deputy commander Col. Mark Kortepeter said it was "extremely unlikely" that any of the center's samples had been smuggled out. "Unlikely," but not impossible.

Amongst the 9,200 extra samples uncovered during the inventory were "bacterial agents that cause plague, anthrax and tularemia; Venezuelan, Eastern and Western equine encephalitis viruses; Rift valley fever virus; Junin virus; Ebola virus; and botulinum neurotoxins." In other words substances which can, and probably have, been weaponized by the Pentagon.

As Antifascist Calling previously reported (http://antifascist-calling.blogspot.com/2009/08/bringing-bio-war-home.html), with "biodefense" as a cover, the U.S. National Security State has spent tens of billions of dollars ($56.9 billion since 2001, according to the Center for Arms Control and Non-Proliferation (http://www.armscontrolcenter.org/policy/biochem/articles/fy09_biodefense_funding/)) on secretive programs investigating the deadliest pathogens known to nature, or ginning up new chimeric monsters in any number of privately-run labs.

The antinuclear watchdog group Tri-Valley CAREs (TVC (http://www.trivalleycares.org/)) obtained documents (http://trivalleycares.presstools.org/node/33429) under the Freedom of Information Act that revealed how Lawrence Livermore National Laboratory (LLNL (http://www.llnsllc.com/)), a "limited liability corporation" overseen by the University of California, Bechtel, BWX Technologies, Washington Group International and Battelle, routinely violated federal regulations and had carried out "restricted experiments" that resulted in the inadvertent release of anthrax in 2005.

Noting that "the relevant details of the 2005 anthrax accident were kept from the public at the time, just as happened with the illegal experiments that are coming to light today," TVC learned that this work is expanding, with little in the way of effective oversight by Congress or indeed, by any regulatory agency.

LLNL has now opened a Biosafety Level 3 (BSL-3) facility and is planning to experiment with pathogens exquisitely suited for use as offensive weapons. Activities contemplated include, "aerosolizing (spraying) pathogens such as plague, tularemia and Q fever, in addition to anthrax. Moreover, government documents disclose that planned experiments in the BSL-3 include genetic modification and potentially novel manipulation of viruses, prions and other agents."

In October, TVC filed a motion (http://trivalleycares.presstools.org/node/34324) for summary judgement in Federal Court in the Northern District of California "aiming to stop the operation of a bio-warfare agent research facility at the Lawrence Livermore National Lab (LLNL) main site in Livermore, California."

According to TVC, "the large inventory of multiple bio-weapon agents, the presence of genetically modified variants, and the fact that some of the pathogens have been put into just the right form to be effectively spread via an airborne release, all serve to make the Livermore BSL-3 a potential magnet for terrorism from either an internal or external source."

Currently, some 400 research facilities and more than 15,000 individuals are cleared "to have access to select agents, which include anthrax, smallpox and the Ebola virus," according to a September report (http://www.ncbi.nlm.nih.gov/bookshelf/picrender.fcgi?book=napp&part=nap12774&blobtype=pdf&blobtype=pdf) by the National Research Council.

The NRC averred that lax security at laboratories that work with select agents "pose a severe risk to human or animal health," risks that "have grown as the amount of research has increased in recent years."

And if one or more of these researchers should "go rogue," for money or as a plausibly deniable component of a Pentagon or CIA operation, doesn't the public have the right to expect the civilian side of government would weed out such miscreants from work with these deadly toxins?

A History of Illicit Research

The close proximity of U.S. biological warfare programs and the pharmaceutical industry is hardly an historical accident. From its inception, American research drew from a rich pool of biomedical researchers backed by the formidable technological resources of Big Pharma.

As Leonard Cole revealed in his 1988 expos, Clouds of Secrecy: The Army's Germ Warfare Tests over Populated Areas, biowarfare research during World War II and the Cold War period was a public/private affair in which the government provided funds to state agencies and private corporations alike in the hope that such solicitous relationships would lead to breakthroughs in the area of offensive weapons or what is now euphemistically called "biodefense."

Indeed, none other than George W. Merck, the president of the Merck Pharmaceutical Company, was a top-flight consultant to the Secretary of War. In that capacity, Merck and his company provided expertise and technological know-how for work on America's nascent biowar programs. In a 1946 report to the Secretary of War penned by Merck, Cole revealed that the program "included research, testing, development, and production of biological agents," all carried out as Merck wrote, in the "strictest secrecy."

While wartime fears of biological attacks by the Axis powers represented a clear and present danger to the United States and their allies as revelations of Nazi Germany and Imperial Japan's active programs attest, this information was scrupulously covered-up and suppressed for decades. Indeed after the war, the United States actively recruited these sociopaths into their biological, chemical and nuclear weapons programs.

As is now known, America's military establishment struck a devil's bargain with the same war criminals who, in the name of science, visited death upon millions. While the doctors and biologists who filled the ranks of Japan's Unit 731 hadn't achieved a "breakthrough" in terms of delivery systems' development, as researcher Sheldon H. Harris revealed in Factories of Death, they possessed an invaluable resource sought by U.S. bioweaponeers: detailed records of the Japanese Army's obscene human experiments.

After the war with a new official enemy looming on the horizon--the Soviet Union--Merck admonished the state to maintain a strong biological warfare program, writing: "Work in this field, born of the necessity of war, cannot be ignored in time of peace; it must be continued on a sufficient scale to provide an adequate defense."

By 1948, the newly-emerging national security state stood-up a Committee on Biological Warfare within the Department of Defense to do just that. Shortly thereafter, the Central Intelligence Agency, particularly the Company's Technical Services Division (TSD), so-called "wizards of Langley," ran a series of illicit programs that sought to "secure the realm" through the application of the latest advances in the biological and psychological sciences.

Over decades, projects such as Bluebird, Artichoke, MKDELTA, MKNAOMI and MKULTRA, variously identified by researchers as "mind control" projects--which they were--garnered outrage when it was revealed during the 1970s that the Agency conspired with leading psychiatrists, psychologists, medical doctors, biologists and academic institutions in funding obscene human experiments employing psychoactive drugs such as LSD, mescaline and BZ on unwitting test subjects.

As the Senate Select Committee on Intelligence Activities, popularly known as the Church Committee, revealed (http://www.druglibrary.org/schaffer/HISTORY/e1950/mkultra/AppendixA.htm) during hearings to examine the Watergate scandals of the 1970s, the Pentagon's own programs ran simultaneously with those of the CIA. The Committee discovered:

In many respects, the Army's testing programs duplicated research which had already been conducted by the CIA. They certainly involved the risks inherent in the early phases of drug testing. In the Army's tests, as with those of the CIA, individual rights were also subordinated to national security considerations; informed consent and followup examinations of subjects were neglected in efforts to maintain the secrecy of the tests. Finally, the command and control problems which were apparent in the CIA's programs are paralleled by a lack of clear authorization and supervision in the Army's programs. (Senate Select Committee on Intelligence Activities, Project MKULTRA, The CIA's Program of Research in Behavioral Modification, United States Senate, August 3, 1977, Appendix A, p. 92)While these projects may only have achieved modest success in standing up programmable assassins, as evidence on Lee Harvey Oswald and Sirhan Sirhan may suggest (http://www.ctka.net/pr598-rfk.html), MKULTRA and its spin-offs were primarily behavioral modification programs subsequently useful for what are now euphemistically termed "enhanced interrogation techniques," e.g., torture and as a formidable bioweapons project.

Indeed, Ft. Detrick's Special Operations Division (SOD), chock-a-block with CIA officers and assets, was, by the early 1950s experimenting with, and assembling biologically-based assassination weapons that were easily concealed and could be deployed by "wet work" specialists to murder foreign leaders such as the multiple failed plots against Fidel Castro, or Patrice Lumumba attest. As researcher Ed Regis documented, Congolese Prime Minister Lumumba was a thorn in the secret state's side.

Refusing to play ball with Washington so as to facilitate the extraction of that nation's vast mineral wealth by American multinational corporations, Lumumba sealed his fate when he sought military assistance from the Soviet Union. At that point, the national liberation leader became an object for Agency "executive action."

It was around this time that the CIA's Deputy Director for Plans, Richard Bissell, had a couple of informal talks with his scientific adviser, Sid Gottlieb, concerning the subject of the covert assassination of foreign leaders. Gottlieb suggested that biological agents were perfect for the task: they were invisible, untraceable, and, if intelligently selected and delivered, not even liable to create a suspicion of foul play. The target would get sick and die exactly as if he'd been attacked by a natural outbreak of an endemic disease. Plenty of lethal or incapacitating germs were out there and available, Gottlieb told Bissell, and they were easily accessible to the CIA. (Ed Regis, The Biology of Doom, New York: Henry Holt and Company, 1999, pp. 182-183)While proponents of continued research with nature's deadliest pathogens argue that the Biological Weapons Convention (BWC) allows for purely "defensive" work to protect the public against potential bioattacks, this mendacious logic studiously avoids the issue of the dual-use nature of this work.

Cole unearthed documents, including a 1968 official history of Ft. Detrick penned by a Pentagon bioweaponeer who asserted forthrightly that "research and development in the offensive aspects of BW proceeded hand in hand with defensive developments for, in truth, the two are almost inseparable."

But MKULTRA and its grisly spin-offs are a thing of the past, right? Not by a long shot!

Jeffrey Kaye, a psychologist and critic of the torture-enabling American Psychological Association (APA), revealed (http://pubrecord.org/torture/6122/investigate-ciarandapa-torture/) November 23, that the group had organized a workshop in 2007 at the Arlington, Virginia headquarters of the dodgy RAND Corporation.

That conference, entitled "Science of Deception: Integration of Practice and Theory (http://www.apa.org/ppo/spin/703.html)," discussed new and novel ways "to utilize drugs and sensory bombardment techniques to break down interrogatees. Those are signal techniques of psychological torture long utilized by the CIA and other intelligence agencies and military around the world."

Citing APA documents, Kaye discovered that APA and their friends at CIA were actively looking for "pharmacological agents ... known to affect apparent truth-telling behavior." Kaye learned that amongst the probative questions driving the spooks and contractors was this revealing sentence: "What are sensory overloads on the maintenance of deceptive behaviors? How might we overload the system or overwhelm the senses and see how it affects deceptive behaviors?"

According to numerous researchers, the CIA, and the psychologists and psychiatrists they contracted to work with them, including many of the top behavioral scientists of their day, experimented with many drugs in their quest to find a truth drug that would open up the recalcitrant and expose the liar and the dissembler. The CIA has declassified a paper from its in-house intelligence journal from the early 1960s, "'Truth' Drugs in Interrogation (https://www.cia.gov/library/center-for-the-study-of-intelligence/kent-csi/vol5no2/html/v05i2a09p_0001.htm)," where they discuss research on drugs for interrogation ranging from scopolamine, amphetamines, and barbiturates to cannabis, LSD, and mescaline. The CIA authors discuss the limitations of using drugs, based on research, and conclude that a special use for drugs may be found in detection of deception. (Jeffrey Kaye, "Who Will Investigate CIA/RAND/APA Torture 'Workshop'?," The Public Record, November 21, 2009)What was true throughout the Cold War period is just as true today and remains a pressing public health issue. As Global Security Newswire reported (http://gsn.nti.org/gsn/nw_20090827_4632.php) in August, the U.S. Army Medical Research Institute of Infectious Diseases (USAMRIID) began construction on a new facility at Ft. Detrick in Frederick, Maryland. The brief report states that "new site will allow for more study of lethal diseases and should have space for 952 staffers, compared to the 800 now using facilities that date back four to five decades."

While the National Academy of Sciences "plans to assess health and safety issues raised by observers who believe there has been insufficient consideration regarding the potential release of an infectious agent from the facility," the same can also be said for the BSL-3 and BSL-4 facilities in private hands, under contract to the U.S. government.

As I reported (http://antifascist-calling.blogspot.com/2009/08/bringing-bio-war-home.html) in "Bringing the (Bio) War Home," the Bulletin of the Atomic Scientists revealed (http://www.thebulletin.org/web-edition/columnists/laura-h-kahn/biosecurity-lessons-the-bruce-ivins-case) that "massive U.S. biodefense spending and a buildup of high-containment laboratories throughout the country might have created an internal security risk that no outside terrorist group could ever duplicate. Nearly two dozen new federal and many more new private biosafety level 3 and 4 laboratories have been built in recent years, meaning a large cadre of scientists has access to extraordinarily lethal material."

And if today's bioweaponeers have their way, such risks will increase exponentially with untold consequences for us all.

Building Banned Weapons

Leading experts (http://www.globalsecurity.org/org/nsn/nsn-060331.htm), as I reported (http://antifascist-calling.blogspot.com/2009/08/dark-winter-for-public-health-meet.html) in August, have derided the possibility that terrorist groups have the know-how to fabricate smallpox or other pathogens into biological weapons as a massive "fraud ... and a substantial one" perpetrated on the American people.

Hysterical claims by securocrats that "bioterrorism is one of the most pressing problems we have on the planet today," an assertion made by Dr. Tara O'Toole, the Undersecretary of Science and Technology at the Department of Homeland Security, is not borne out by the facts.

Indeed, such claims not only distort available evidence that terrorist groups have such capabilities but conceal the more salient fact that Pentagon weaponeers continue to build banned weapons.

According to Jeanne Guillemin, author of Biological Weapons: From the Invention of State-Sponsored Programs to Contemporary Bioterrorism, the Pentagon and CIA made and tested a model of a Soviet anthrax bomb and created an antibiotic-resistant strain of anthrax.

After consulting with scientists who strongly suggested that the CIA anthrax bomb project would violate the BWC, "CIA lawyers decided the project was within the allowed realm of defensive research," Guillemin revealed.


Project Clear Vision, a joint investigation by the CIA and the Battelle Memorial Institute, under contract to the Agency, reconstructed and tested a Soviet-era anthrax bomblet in order to test its dissemination characteristics. The Agency "decided the same" for the small, fully functional bioweapons facility built under the rubric of Project Bacchus.

The third initiative, Project Jefferson, led to the development of an antibiotic-resistant strain of anthrax based on a Soviet model. After the outgoing Clinton administration hesitated to give the CIA the go-ahead for the project, the Bush regime's National Security Council gave the Pentagon permission. "They believed" Guillemin wrote, "the Pentagon had the right to investigate genetically altered pathogens in the name of biodefense, 'to save American lives'."

Shortly thereafter, the Pentagon authorized the Defense Intelligence Agency (DIA), one of the most secretive and heavily-outsourced Defense Department branches, to re-create the deadly anthrax strain.

Commenting on the close proximity of the 2001 anthrax provocation and the rush towards the invasion and occupation of Iraq, constitutional law expert Glenn Greenwald writes (http://www.salon.com/news/opinion/glenn_greenwald/index.html?story=/opinion/greenwald/2009/11/27/anthrax) that the anthrax attack "played at least as large of a role as the 9/11 attack itself, if not larger, in creating the general climate of fear that prevailed for years in the U.S. and specifically how the anthrax episode was exploited by leading media and political figures to gin up intense hostility towards Iraq."

Which is why, according to Greenwald, "it's so striking how we've collectively flushed this terrorist attack down the memory hole as though it doesn't exist." Indeed, "what makes this particularly significant is that the anthrax attack is unresolved and uninvestigated."

Here we have one of the most consequential political events of the last decade at least--a lethal biological terrorist attack aimed at key U.S. Senators and media figures, which even the FBI claims originated from a U.S. military lab. The then-British Ambassador to the U.S. is now testifying what has long been clear: that this episode played a huge role in enabling the attack on Iraq. Even our leading mainstream, establishment-serving media outlets--and countless bio-weapons experts--believe that we do not have real answers about who perpetrated this attack and how. And there is little apparent interest in investigating in order to find out. Evidently, this is just another one of those things that we'll relegate to "the irrelevant past," and therefore deem it unworthy of attention from our future-gazing, always-distracted minds. (Glenn Greenwald, "A key British official reminds us of the forgotten anthrax attack," Salon, November 27, 2009)On and on it goes, America's headlong rush into the abyss.

While the American people believed the election of Barack Obama signaled a change in direction from decades' long policies that have brought the planet to the brink of disaster, those hopes are little more than cynical illusions manufactured by media specialists and spin-doctors, the ubiquitous army of "message force multipliers" who do the bidding of their corporatist masters.

After all, $57 billion buys much in the way of silence.



Posted by Antifascist at 5:14 PM (http://antifascist-calling.blogspot.com/2009/12/public-menace-private-profit-americas.html)

While I myself have not worked with such disease organisms, I have worked with persons who did. It is INDEED very rare for some researcher to be infected, much less die. The negative pressure containment labs and other precautions almost rule that out, except in the case they were targeted by others to so die of the organism they were working with, to make it look like an 'accident'. An actual accident can not be ruled out, but given how things have played out since the Second World War, I'd want to know more about the dead researchers motives, life, political beliefs and who his enemies might be.

Magda Hassan
01-08-2010, 09:16 AM
EU to probe pharma over false pandemic
04 January 2010
The Parliamentary Assembly of the Council of Europe (PACE) is to hold an emergency debate and inquiry this month into the influence exerted by drugmakers on the World Health Organisations (WHO) global H1N1 flu campaign.

The text of the resolution approved by the Assembly calling for the debate and inquiry states that: in order to promote their patented drugs and vaccines against flu, pharmaceutical companies influenced scientists and official agencies responsible for public health standards to alarm governments worldwide and make them squander tight health resources for inefficient vaccine strategies, and needlessly expose millions of healthy people to the risk of an unknown amount of side-effects of insufficiently tested vaccines.

The WHOs false pandemic flu campaign is one of the greatest medicine scandals of the century, according to Dr Wolfgang Wodarg, chairman the PACE Health Committee, who introduced the parliamentary motion. The definition of an alarming pandemic must not be under the influence of drug-sellers, he adds.

Dr Wodarg, a doctor and former SPD member of the German Bundestag, says that the false pandemic campaign began last May in Mexico City, when a hundred or so normal reported influenza cases were declared to be the beginning of a threatening new pandemic, although there was little scientific evidence for this. Nevertheless the WHO, in cooperation with some big pharmaceutical companies and their scientists, re-defined pandemics, removing the statement that an enormous amount of people have contracted the illness or died from its existing definition and replacing it by stating simply that there has to be a virus, spreading beyond borders and to which people have no immunity.

These new standards forced politicians in most states to react immediately and sign marketing commitments for additional and new vaccines against swine flu, through sealed contracts under which orders are secured in advance and governments take almost all responsibility. In this way, the producers of vaccines are sure of enormous gains without having any financial risks. So they just wait until WHO says pandemic and activate the contracts, says Dr Wodarg.

In January, we will arrange an emergency debate about the influence of the pharmaceutical industry on the WHO, and 47 parliaments all over Europe are going to be informed. Following this, we will initiate an investigation and hearings involving those responsible for the pandemic emergency. The aim is that none of the pharmaceutical companies under any circumstances must be allowed to make their influence felt on pandemic emergencies, he went on.

The victims among millions of needlessly vaccinated people must be protected by their states, and independent scientific clarification should provide evidence and transparency for national and, if necessary, European courts, added Dr Wodarg.
http://www.pharmatimes.com/WorldNews/article.aspx?id=17147

David Guyatt
02-03-2010, 10:27 AM
I have today asked the government's Chief Medical Officer to provide the current number of deaths attributable to swine flu - and will post the reply here when received. The last published figure I can find was 29 in Summer 09. Nothing since then, it seems. Anyway, it will be interesting to see just how much hype there was.

Meanwhile, the fortnightly bulletin issued by the CMO about swine flu has been terminated. The epidemic is effectively over.

But the profits continue to roll in.

Yours cynically,

http://news.bbc.co.uk/1/hi/business/8494892.stm


Tamiflu sales boost Roche profits

http://newsimg.bbc.co.uk/media/images/45987000/jpg/_45987312__45705292_tamiflu226i-1.jpg

Swiss drugs firm Roche has reported an 8% rise in annual sales, helped by sales of swine flu drug Tamiflu and cancer treatments, such as Herceptin.

The rate of growth is twice the industry average and operating profits were up by 14% to 15bn Swiss francs ($14.2bn, 8.89bn).

However, overall net income for the year fell 22% to 8.5bn Swiss francs as a result of takeover costs.

Last year, Roche bought US pharmaceutical giant Genentech.

It says that this deal is already proving profitable.

Although sales of Tamiflu soared last year, they are expected to fall sharply in 2010, to 1.2bn Swiss francs from 3.2bn Swiss francs in 2009.

Peter Lemkin
02-03-2010, 10:49 AM
The Czech Republic's chief hygiene officer, Michael Vit, says he has
probably caught the swine flu virus, the news website novinky.cz
reported on Tuesday. Mr Vit said he had several symptoms of flu and was
convinced it was swine flu. He had been vaccinated against regular flu,
but not the H1N1 virus, saying he had planned to get a jab against the
latter this week. On Monday the Czech government said that if there is
an epidemic of swine flu it will be up to the chief hygiene officer to
decide whether to introduce mandatory vaccinations for around 200,000
workers regarded as key to the functioning of the state.

Peter Lemkin
02-03-2010, 10:51 AM
I hate to credit the BBC with anything, but they did [last few days] a good piece on the fake 'pandemic' and hinted that there are Big Pharma agents within WHO. Catch it on the BBC websites. :ciao:

David Guyatt
02-03-2010, 11:49 AM
I hate to credit the BBC with anything, but they did [last few days] a good piece on the fake 'pandemic' and hinted that there are Big Pharma agents within WHO. Catch it on the BBC websites. :ciao:

Thanks Pete. The BBC report is below and nothing more need be said really, fraud is fraud.

http://news.bbc.co.uk/1/hi/health/8455035.stm


WHO to review swine flu response
By Imogen Foulkes
BBC News correspondent in Geneva

http://newsimg.bbc.co.uk/media/images/47096000/jpg/_47096136__46947284_000169628-1-1.jpg

The World Health Organization (WHO) is to review its handling of the HIN1 swine flu pandemic, once it is over.

The WHO has been facing charges from some European politicians that it exaggerated the dangers of swine flu.

More than 12,700 people worldwide have died from H1N1 - but the virus has turned out to less deadly than feared.

However, the WHO initially urged rapid development of treatments and vaccines, fearing the virus had the potential to kill millions.

As a result wealthy countries spent billions on medicines which many believe are now unnecessary.

Across Europe, governments are trying to resell their stockpiles of swine flu vaccine.

The Council of Europe is planning an investigation, to begin later this month, into whether pharmaceutical companies influenced public health officials to spend money unnecessarily.

In Geneva, a WHO spokeswoman acknowledged there were questions to be answered.

She said the the review of its management of the pandemic would be conducted with independent experts, and the results would be made public.

However, the review will not begin until the pandemic itself is declared over - and that could still be months away.

David Guyatt
02-08-2010, 03:40 PM
I have today asked the government's Chief Medical Officer to provide the current number of deaths attributable to swine flu - and will post the reply here when received. The last published figure I can find was 29 in Summer 09. Nothing since then, it seems. Anyway, it will be interesting to see just how much hype there was.

Meanwhile, the fortnightly bulletin issued by the CMO about swine flu has

Just received the reply from the governments Chief Medical Officer. The number of deaths attributed to Swine 'flu in the Uk, as of 4th February 2010 stands at 411.

This is in contradistinction to the average number of deaths attributed during the Winter to ordinary 'flu in an average year are around 12,000, and in a low flu year may be as little as 3-4000 (see: http://www.jabs.org.uk/forum/topic.asp?TOPIC_ID=58).

While Winter is not yet over in the UK, the flu "pandemic" is certainly well over and done with and the number of additional deaths will probably and hopefully) be very low.

In al all, this clearly suggests that Swine flu was very good for us all...

And for LaRoche too.

Keith Millea
02-11-2010, 03:53 AM
I've been keeping track of the H1N1 virus here in my State of Oregon.This page lists the number of hospitalizations and deaths by county.

http://www.oregon.gov/DHS/ph/acd/swineflu_investigation.shtml#current



This link has a good chart of the progression of the virus.Note that the big spike in cases was from the back to school timeframe.

Chart of Influenza Hospitalizations and Deaths by Week (pdf) (http://www.oregon.gov/DHS/ph/acd/flu/hosp_death.pdf)

Ed Jewett
02-11-2010, 07:46 AM
I have it on good authority from personal sources working at high levels within the health care system that formal testing in this geographical area and systems milieu stopped happening some months ago... the tests are bothersome, cumbersome, ofttimes inaccurate, so the diagnosis of H1N1 is made under curious, sloppy, or even automatic circumstances. It seems also fairly obvious now from a statistical perspective that whatever the H1N1 thing was, it was not nearly as fatal as the normal seasonal flu variant. The idea that this is a "bug" designed to boost pharmaceutical purchases has long been present, has essentially been proven, and is consistent with the Hegelian approach now widely used to generate cash flow from our pockets to someone else's. Soon, I anticipate an outbreak of ayatollah-litis or antibiotic-resistant Ahmadinejad hemorrhagic fever necessitating the infusion of significant undercover spores armed with micro-Predators that have been saturated in depleted iodine. Line up early for your injection. :reddy:

David Guyatt
02-11-2010, 09:08 AM
This is also true for the UK Ed. If you have flu like symptoms you are not permitted to visit your doctor but must phone them.

Diagnosis and treatment is conducted over the phone.

The apparent symptoms can be identical to the plain vanilla annual flu because in order to determine if it is pig flu, a blood test is required.

And the last time I paid attention, this was not possible over the phone.

The whole thing has been a load of old bollocks and undoubtedly is a artful financial fraud.

Peter Presland
02-11-2010, 11:00 AM
This is also true for the UK Ed. If you have flu like symptoms you are not permitted to visit your doctor but must phone them.
I had occasion to be sitting in our local health centre waiting room back in October last year. They have one of those old-fashioned long LCD strips that run messages across them at well below reading speed. To while away the wait, it can be quite entertaining to second guess what's coming next.

On this occasion I was watching a crude image of a tank (I kid you not) trundling along in front of a message that gradually read "If you think you may have swine flu, please..." Screen full so a pause before next line.

Naturally enough I filled it in mentally with "bugger off and go home" and a few other choice suggestions.

And, in essence that is indeed what it said - only in the usual bureaucrat-speak.

I had a bit of a laugh with my Doc about when I got to see him - we usually spend more time discussing ephemera than my trivial medical concerns anyway - He told me that indeed they were given strong advice - to be ignored at their peril - to treat the whole question of 'Swine flu' as a grave risk and to give it prominence etc etc. I suggested he substitute 'Pig' for 'Swine' and make the position of the sign pause a little less inviting of ridicule.

But we agreed that to have a good chuckle at it was probably in the nature of a tonic - better capable of staving it off (and less potentially damaging) than the mercury-adjuvant containing vaccine they were offering - and being number-of-doses-administered targeted on.

Ed Jewett
02-11-2010, 07:27 PM
And the last time I paid attention, this was not possible over the phone.


Given the CIA's work in killer cigars and wet suits, the NSA relationships with numerous phone and Internet carriers, the use of cell phones as device triggers, and the flurry of work being done by DARPA lately, it is only a matter of time before they have it so that my phone wil ring and it will say "You will self-destruct in three seconds..."
:heeeelllllooooo:

Jan Klimkowski
02-11-2010, 09:01 PM
I had a bit of a laugh with my Doc about when I got to see him - we usually spend more time discussing ephemera than my trivial medical concerns anyway - He told me that indeed they were given strong advice - to be ignored at their peril - to treat the whole question of 'Swine flu' as a grave risk and to give it prominence etc etc. I suggested he substitute 'Pig' for 'Swine' and make the position of the sign pause a little less inviting of ridicule.

But we agreed that to have a good chuckle at it was probably in the nature of a tonic - better capable of staving it off (and less potentially damaging) than the mercury-adjuvant containing vaccine they were offering - and being number-of-doses-administered targeted on.

I think we should call it Big Pharma Big Profit Flu from now on. However, as that is rather cumbersome, I'm happy to shorten it to plain vanilla Pig Flu.

Like David G and Peter P I can confirm that, in the UK, diagnosis of Pig Flu was no diagnosis at all. If you sneezed, you were told to quarantine yourself at home and guzzle chicken soup whilst wearing several moth-eaten jumpers. If you insisted, you could call a central number where your phonecall would be answered by people recruited from the local Job Centre Plus, who would ask you some questions, tick some boxes, and if enough boxes were ticked, a courier (possibly also recruited from the queues at the local Job Centre Plus) would shove some Tamiflu through your letter box and run away.

I didn't have any symptoms, but many people I know had the above process inflicted on them. In addition, none of them had anything more debilitating than minor flu symptoms and perhaps a brief period of the trots.

So, yes, the real incidence of Pig Flu amongst the more regular flus was either tiny or Pig Flu really is so mild as to be an irrelevance.

The profits of Big Pharma were not irrelevant.

Peter - the comments of your GP about the central government advice, or more accurately pressure, he received to treat Pig Flu as a "grave risk" are interesting and also ring true.

David Guyatt
02-12-2010, 10:58 AM
Like David G and Peter P I can confirm that, in the UK, diagnosis of Pig Flu was no diagnosis at all. If you sneezed, you were told to quarantine yourself at home and guzzle chicken soup whilst wearing several moth-eaten jumpers.

The old remedies are the best, eh. :flute:

Magda Hassan
03-29-2010, 07:58 AM
Two cases with rapid development of drug-resistant 2009 H1N1 influenza reported


2010-03-27 16:30:00

Scientists have reported two cases in which people with compromised immune systems who became ill with 2009 H1N1 influenza developed drug-resistant strains of virus after less than two weeks on therapy.
Doctors from the National Institute of Allergy and Infectious Diseases (NIAID), part of the National Institutes of Health, have said that medics, who treat prolonged influenza infection should be aware that even a short course of antiviral treatment may lead to drug-resistant virus.
They also said that the authors, and clinicians should take into mind this possibility while developing initial treatment strategies for their patients who have impaired immune function.
Both patients in the new report developed resistance to the key influenza drug oseltamivir (Tamiflu), and one also demonstrated clinical resistance to another antiviral agent, now in experimental testing, intravenous peramivir, said senior authors Dr. Matthew J. Memoli and Dr. Jeffery K. Taubenberger.
This is the first reported case of clinically significant peramivir-resistant 2009 H1N1 illness, say the scientists.
The people in the current case report had immune limitations due to blood stem cell transplants that occurred several years previously. Both recovered from their influenza infections.
"While the emergence of drug-resistant influenza virus is not in itself surprising, these cases demonstrate that resistant strains can emerge after only a brief period of drug therapy. We have a limited number of drugs available for treating influenza and these findings provide additional urgency to efforts to develop antivirals that attack influenza virus in novel ways," said NIAID Director Anthony S. Fauci.
The 2009 H1N1 influenza virus is susceptible to just one of the two available classes of anti-influenza drugs, the neuraminidase inhibitors. Besides oseltamivir, other neuraminidase inhibitors are zanamivir (Relenza), which is inhaled, and the intravenously administered investigational drug peramivir.
It was shown that some strains contained a genetic mutation (the H275Y mutation) that makes the virus less susceptible to some neuraminidase inhibitors.
The two people in the current case study had pre-existing medical conditions that impaired their immune system function before contracting 2009 H1N1 flu.
In the newly described cases, the mutation appeared after 14 days in one individual and after nine days in the second.
The study will appear in Clinical Infectious Diseases. (ANI)
http://sify.com/news/two-cases-with-rapid-development-of-drug-resistant-2009-h1n1-influenza-reported-news-international-kd1q4ehiihg.html


http://im.sify.com/images/corner-3.png

SEARCH

http://im.sify.com/images/google1.jpg

http://im.sify.com/images/icon1.jpg


http://im.sify.com/images/corner-4.png




http://im.sify.com/news/images/images2008/spacer.gif

David Guyatt
04-10-2014, 08:58 AM
First the new news:




The drugs don't work: Britain wasted £600m of taxpayers' money on useless flu pills stockpiled by Government in case of pandemic

http://www.independent.co.uk/incoming/article9249544.ece/ALTERNATES/w620/web-flu-1-getty.jpg

Pharmaceutical giants failed to disclose crucial data revealing concerns over their products Tamiflu and Relenza

STEVE CONNOR (http://www.independent.co.uk/biography/steve-connor)http://www.independent.co.uk/skins/ind/images/plus.png

SCIENCE EDITOR

Thursday 10 April 2014

Britain has spent £600m on a stockpile of influenza drugs that are no better than paracetamol in relieving flu symptoms and are next to useless in preventing a pandemic, a major study has found.

The companies behind the two main anti-influenza drugs Tamiflu and Relenza held back crucial information that would have shown just how ineffective their drugs were in clinical trials, according to the independent scientists who compiled the report.
Their investigation found little or no evidence to support the manufacturers’ claims about the effectiveness of the two drugs and questioned the Government’s rationale for building up an emergency stockpile of 40 million doses.
The scientists also criticised the drug-regulatory authorities for failing to ask for the full details of the clinical trials to be released before giving their approval.
In a searing indictment of the opacity of the pharmaceuticals industry, the ineffectiveness of the drug-regulatory process and the gullibility of politicians and government scientific advisers, the report delivers an excoriating account of one of the biggest drug scandals of the century.
The main authors of the report, compiled by the respected Cochrane Collaboration of independent medical scientists, advised the Government not to buy any further stocks of Tamiflu or Relenza to replace those in the stockpile that are coming to the end of their shelf life. They also urged the World Health Organisation to reconsider its recommendation for national stockpiles to combat an influenza pandemic.
Details buried within the 175,000 pages of clinical trials data held by the drug companies revealed that the only benefit of the anti-flu drugs was that they shortened the period of symptoms by about half a day. However, symptom relief was not the reason for justifying an expensive stockpile by the Government.
There was no evidence within the thousands of pages of clinical trial data to support the official rationale for the stockpile, namely that the drugs prevented dangerous complications such as pneumonia and slowed down the transmission of the virus within the population.
“The symptom relief is about half a day, but the indications are that the symptom relief is no better than medications you can get over the counter,” said Carl Heneghan, professor of evidence-based medicine at the University of Oxford and one of the study’s lead authors.
“There is no credible way that these drugs could prevent a pandemic. You’d have to treat 80 per cent of the population for eight weeks and have a vaccine immediately available even if you assume that it actually does work,” Professor Heneghan said.
More worrying, however, was the evidence indicating that Tamiflu – which makes up about 85 per cent of the stockpile – when taken as a preventative medicine may result in serious side effects, such as kidney problems, high blood sugar and psychiatric disorders such as depression and delirium.
“The idea of a drug is that the benefit should exceed the harm. If you can’t find a benefit, then you accentuate the harm,” Professor Heneghan said. In Japan there have been cases of children harming themselves after taking the drug, he added.
http://www.independent.co.uk/incoming/article9249545.ece/ALTERNATES/w460/web-flu-2-ap.jpgTamiflu, produced by Roche, makes up about 85 per cent of the UK’s stockpile (AP)
These side effects and the bias placed on the benefits of the drugs should have been picked up by the regulatory authorities, namely the European Medicines Agency (EMA) and the National Institute for Health and Care Excellence (Nice), which are responsible for drug approval and licensing.
“Once a drug goes into the marketing stage, most of the science goes out of the window so it’s the regulators’ job to go in there and be really tough and ask for all the evidence – and that has not occurred,” Professor Heneghan said.
As a result, more than £600m of taxpayers’ money has been “thrown down the drain” on a stockpile of anti-viral influenza drugs that effectively do not work as billed and can cause serious side-effects in a significant minority of people, he added.
Fiona Godlee, editor-in-chief of the British Medical Journal (BMJ), who has led the campaign for more openness from the drugs industry, said: “The current system isn’t working. There is an irreducible conflict of interest that the pharmaceutical companies have. They manufacture these drugs and they have a duty to their shareholders to make a profit.
“It’s not in their interests to create a clear picture of the drug. We have evidence again and again that the published evidence is biased and over optimistic about the benefits, and yet understates the harm,” she added.
It took more than four years of arduous negotiations to convince the Swiss company Roche, which makes Tamiflu, and the British firm GSK, the manufacturers of Relenza – a powder taken by inhalation – to release the full details of their 46 clinical trials to the Cochrane collaboration.
After years of stonewalling, GSK relented with its full submission of its 26 Relenza trials last year, which was soon followed by Roche’s release of its 20 Tamiflu trials.
http://www.independent.co.uk/incoming/article9249551.ece/ALTERNATES/w460/WEB-FLU-3-GETTY.jpgPublic information leaflets commissioned by the British Department of Health (Getty)
Tom Jefferson, an epidemiologist and former GP who was the lead author of the study, said that the EMA approved Tamiflu – an oral tablet – on the basis of 16 clinical study reports provided by the company, of which only one was complete, the rest being either a summary or incomplete.
“That is not [the fault of] Roche. The EMA had the legal power to demand the full set, to demand anything they wanted, to inspect anything they want. It isn’t Roche, it’s the EMA, it’s the regulators,” Dr Jefferson said.
Daniel Thurley, UK medical director of Roche, said: “We disagree with the overall conclusions of this report. Roche stands behind the wealth of data for Tamiflu and the decisions of public health agencies worldwide.”
A spokeswoman for the Department of Health said: “Tamiflu is licensed around the world for the treatment of seasonal flu and is a licensed product with a proven record of safety, quality and efficacy. We regularly review all published data and will consider the Cochrane review closely.”
A spokeswoman for GSK said: “We continue to believe the data from Relenza’s clinical trial programme support its effectiveness against flu and that when used appropriately, in the right patient, it can reduce duration of flu symptoms.”
The drugs
Tamiflu and Relenza work in a similar way by blocking a vital enzyme of the influenza virus, called neuraminidase, which enables the virus to reproduce by budding off from the host cells that it infects.
However, the two neuraminidase inhibitors are very different from one another. Tamiflu, made by the Swiss company Roche and known by its generic name of oseltamivir, is taken as an oral pill, whilst Relenza (zanamivir), made by GSK, is inhaled as a powder, which limits its usefulness.
Relenza was the first neuraminidase on the market, but Tamiflu came along a few months later and quickly became the anti-flu pill of choice. About 85 per cent of the UK’s national anti-flu drug stockpile is Tamiflu, with the remainder being Relenza, which is kept in case of resistance.
In 2007, Japan’s Health Ministry reported that a number of children had been injured or killed after taking Tamiflu, some by jumping from buildings or falling in front of moving vehicles.


And now for the old news:








Tamiflu – a Worthless Drug

by F. William Engdahl, Germany

“Gilead is fortunate to have had Don Rumsfeld as a stalwart board member since the company’s earliest days, and we are very pleased that he has accepted the Chairmanship,” Dr. Riordan said. “He has played an important role in helping to build and steer the company. His broad experience in leadership positions in both industry and government will serve us well as Gilead continues to build its commercial presence.”Press release by Gilead Sciences Inc., 1997
Is Avian Flu Another Pentagon Hoax?

Against all scientific prudence and procedure the world population is being whipped up by irresponsible public health officials from WHO to the United States Centers for Disease Control about the imminent danger that a malicious viral strain might spread from infected birds, primarily in Vietnam and other Asian centers, to contaminate the entire human species in pandemic proportions.The only medicine we are told which reduce the symptoms of general or seasonal influenza and “possibly” might reduce symptoms also of Avian Flu, is a drug called Tamiflu. Today the giant Swiss pharmaceutical firm, Roche, holds the sole license to manufacture Tamiflu. Due to the media panic, the order books at Roche today are fuilled to overflowing.What is not so widely known is that Tamiflu was developed and patented by a California biotech firm, Gilead Sciences Inc., a NASDAQ (GILD) listed stock company which prefers to maintain a low profile in the current rush to Tamiflu. That might be because of who is tied to Gilead. In 1997, before he became US Secretary of Defense, Donald H. Rumsfeld was named Chairman of the Board of Gilead Sciences, where he remained until early 2001 when he 
became Defense Secretary. Rumsfeld had been on the board of Gilead since 1988 according to a January 3 1997 company press release.An as-yet-unconfirmed report is that Rumsfeld while Secretary of Defense also purchased an additional stock in his former company, Gilead Sciences worth $18 million making him one of its largest if not the largest stock owners. He stands to make a fortune on royalties as a panicked world population scrambles to buy a drug worthless in curing effects of alleged Avian Flu. The model suggests the parallel to the brazen corruption of Halliburton Corporation whose former CEO is Vice President Dick Cheney. Cheney’s company has so far gotten billions worth of US construction contracts in Iraq and elsewhere. Coincidence that Cheney’s closest political friend is Defense Secretary and Avian Flu beneficiary Don Rumsfeld? It is another example of what someone has called the principle of modern US corrupt special interest politics: “Concentrate the benefits; diffuse the costs” President Bush has ordered the US Government to buy $2 billion worth of Gilead Science’s Tamilflu.This seems not to be the end of the story. British scientists are reportedly genetically engineering chickens to produce birds resistant to the lethal strains of the H5N1 virus devastating poultry in the Far East. Could a fake Avian Flu hype be merely the pretext to control Asian poultry supplies with Genetically Modified products along with rice?Not long ago, President Bush sought to instill panic in this country by telling us a minimum of 200'000 people will die from the avian flu pandemic, but it could be as bad as 2 million deaths in this alone.This hoax is then used to justify the immediate purchase of 80 million doses of Tamiflu, a worthless drug that in no way shape or form treats the avian flu, but only decreases the amount of days one is sick and can actually contribute to the virus having more lethal mutations.So the U.S. placed an order for 20 million doses of this worthless drug at a price of $100 per dose. That comes to a staggering $2 billion.Michel Chossudovsky, Global Research (http://www.globalresearch.ca/), 26 Oct 2005
( (http://www.globalresearch.ca/index.php?context=viewArticle&code=%20ME20051026&articleId=1148)www.globalresearch.ca/index.php?context=viewArticle&code=%20ME20051026&articleId=1148 (http://www.globalresearch.ca/index.php?context=viewArticle&code=%20ME20051026&articleId=1148))



http://www.currentconcerns.ch/config_03/pixel.gif








Article published on 06-11-2005