Thread Rating:
  • 0 Vote(s) - 0 Average
  • 1
  • 2
  • 3
  • 4
  • 5
Is This The Long Awaited Pandemic?
#71
US Patent 6117667 - Method for producing an adapted virus population from an African green monkey kidney cell line


Inventors

Assignee

Application

No. 336740 filed on 06/21/1999 US Classes:

435/235.1, VIRUS OR BACTERIOPHAGE, EXCEPT FOR VIRAL VECTOR OR BACTERIOPHAGE VECTOR; COMPOSITION THEREOF; PREPARATION OR PURIFICATION THEREOF; PRODUCTION OF VIRAL SUBUNITS; MEDIA FOR PROPAGATING435/239Recovery or purificationField of Search

435/235.1, VIRUS OR BACTERIOPHAGE, EXCEPT FOR VIRAL VECTOR OR BACTERIOPHAGE VECTOR; COMPOSITION THEREOF; PREPARATION OR PURIFICATION THEREOF; PRODUCTION OF VIRAL SUBUNITS; MEDIA FOR PROPAGATING435/239Recovery or purificationExaminers

Primary: McKelvey, Terry
Attorney, Agent or Firm

US Patent References

4783407Growth of hepatitus A virus in vero cells
Issued on: 11/08/1988
Inventor: Provost , et al.International Classes

C12N 007/00
C12N 007/02
US Patent Issued on September 12, 2000
Estimated Patent Expiration Date: [Image: icon_subject.gif] June 21, 2019Estimated Expiration Date is calculated based on simple USPTO term provisions. It does not account for terminal disclaimers, term adjustments, failure to pay maintenance fees, or other factors which might affect the term of a patent.
Abstract Claims Description Full Text
loading...
[Image: 6117667.png]


View Patent Images (PDF)
(Registered users only)

Description



FIELD OF INVENTION

The invention relates to a novel African Green Monkey Kidney (AGMK) cell subtrate that supports the efficient replication of human and animal rotaviruses, astroviruses, enteroviruses including the Sabin live attenuated poliovirus vaccine strains, hepatitis A virus and respiratory viruses such as respiratory syncytial virus, parainfluenza viruses, and influenza A and B viruses.

The invention is also useful for the production of virus suspensions suitable for use in vaccines for immunization of humans.

BACKGROUND OF INVENTION

Rotaviruses are major causal agents of acute gastroenteritis in man with a world-wide distribution. Enteroviruses have been implicated in infections of the gastrointestinal tract, the respiratory system and in aseptic meningitis. Respiratory syncytial virus (RSV), the parainfluenza viruses and the influenza viruses have been shown to be the major causal agents of serious pediatric diseases such as croup, bronchiolitis and pneumonia, while the influenza viruses are the major cause of serious febrile respiratory tract illness in adults. Hepatitis A virus is the cause of hepatitis A, one of the major infectious diseases of the liver.

Rotavirus infections occur world-wide and are responsible for a large proportion of severe, life-threatening, often fatal diarrheal disease. Most rotavirus disease is caused by the four major human rotavirus serotypes but other serotypes are being discovered continuously. The latter are usually restricted in geographic distribution, but they could become a larger problem at any time. World-wide, the human rotaviruses are the major etiologic agents of serious acute gastroenteritis in infants and young children and on occasion can cause debilitating diarrhea in adults. It has been estimated by the World Health Organization that rotaviruses are responsible for one million fatal diarrheal illnesses each year in infants and young children in developing countries.

The most important cause of serious viral respiratory illness in children is respiratory syncytial virus (RSV). The parainfluenza viruses, influenza viruses, and adenoviruses are also important in this regard. Especially in the case of respiratory syncytial virus (RSV), of which there are two major subgroups A and B, immunity does not appear to be long-lasting and re-infections can and do occur with high frequency during infancy, through the pre-school period, and throughout adult life. The parainfluenza viruses, of which there are four major types--1, 2, 3 and 4--have been implicated as important causes of croup, bronchiolitis and pneumonia in infants and young children. These viruses are second only to RSV as a cause of severe viral respiratory tract disease. In adults, the influenza viruses are a major cause of mortality in older persons with underlying acute or chronic cardiac or pulmonary disease. The serious systemic disease manifestations of influenza virus infections are well known and the frequent antigenic shifts in serotype [A/H1N1, A/H3N2 and B] necessitate changes in the composition of the strains included in the yearly vaccine preparations.

The enteroviruses, which are a subgroup of picornaviruses consisting of polioviruses, Coxsackie viruses and echoviruses, have been shown to cause a broad spectrum of illnesses. These illnesses include paralytic disease, encephalitis, aseptic meningitis, pleurodynia, exanthems, and pericarditis with some of the infections resulting in debilitating sequelae. Hepatitis A virus, also a picornavirus, is a major cause of sporadic as well as epidemic hepatitis.

According to convention, semi-continuous cell systems which are diploid and have a finite longevity in terms of the number of passages that can be achieved in the laboratory are designated as cell strains, whereas continuous cell systems that are aneuploid and can be passaged indefinitely in the laboratory (i.e., are immortal) are designated as cell lines. A limiting factor in the development of vaccines for combating the maladies caused by a number of these infectious agents has been the lack of availability of an acceptable cell strain or line capable of supporting the growth of these viruses to a concentration suitable for use in vaccine production. Convenient and susceptible cell strains and/or lines that can be cultured using relatively high split ratios (i.e., the preparation of multiple tissue culture vessels from a single culture) and which can be approved for human use by the Center for Biologics Evaluation and Research (CBER) of the Food and Drug Administration (FDA) are needed to enable and facilitate vaccine development for certain medically important viruses that are uncontrolled currently.


Semi-continuous or continuous cell culture systems capable of supporting the growth of hybrid rotaviruses, hereafter designated human x animal rotavirus reassortants, have included the simian cell strain, FRhL-2, and the simian cell lines, CV-1 and Vero. Live virus vaccines produced in these cells have received CBER, FDA approval for Phase I and II studies. Henceforth, we will refer to these cell strains or lines as certified cell strains or lines to distinguish them from cell strains or lines that have been licensed for production of human vaccines. To date, only two semi-continuous cell culture systems, WI-38 and MRC-5, both human fetal diploid cell strains, have been licensed for use in virus vaccines. These cell strains will be referred to as licensed cell strains. Currently, there are no licensed continuous cell lines.

The above mentioned certified cell strain or lines (FRhL-2, CV-1 and Vero) are limited in their ability to support the growth of completely homologous human rotaviruses, i.e., rotaviruses that derive each of their 11 RNA gene segments from a human rotavirus. In addition, the FRhL-2 cell strain, with a maximum 1:3 split ratio capability, is limited in its ability to support the growth of important RSV. The CV-1 cells, with a maximum 1:4 split ratio capability, have not supported the growth of many viral agents to a level satisfactory for vaccine production. The Vero cells, with a split ratio of 1:6-1:10, are limited in their ability to support the growth of a number of enteroviruses and fail to support the efficient growth of completely homologous human rotaviruses.

Naturally occurring strains of hepatitis A virus (HAV), a picornavirus distantly related to the enteroviruses, do not grow well in any cell type during primary isolation and must be adapted to growth in cells of primate origin before the level of virus replication required for vaccine development and production can be achieved. Inactivated whole-virus HAV vaccines grown in fetal human fibroblast MRC-5 cells have been developed, but the low split ratio of 1:2 required by these cells, the low viral titers achieved, and the prolonged cultivation time of up to two weeks necessary for maximum yield of viral antigen make such vaccines expensive. Growth of HAV in simian CV-1, FRhK4 (a fetal rhesus monkey kidney cell line), FRhK-6 (another fetal rhesus monkey kidney cell line) and Vero cells has been variable depending on the strain and passage level of virus, but generally is suboptimal. Best growth has been obtained in a cloned cell line, designated clone 11-1, derived from FRhK4 cells, but these cells contain bovine papilloma virus sequences and thus, are not suitable for vaccine development.

Candidate live attenuated and inactivated HAV vaccines have been developed by adaptation of the virus to growth in primary African green monkey (AGMK) cells but such vaccines are not economically feasible because of the extreme difficulty of obtaining sufficient primary AGMK cells that are free of extraneous viral agents of monkey origin. Live attenuated and inactivated HAV vaccine candidates have been adapted to growth in MRC-5 cells, a human fetal diploid cell strain, but such adaptation has consistently led, respectively, to over-attenuation of the live attenuated virus for humans and a relatively sparse yield of inactivated virus vaccine.

Thus, there remains a need for a cell strain or line capable of supporting the efficient growth of a large number of human viral pathogens such as the human rotaviruses, enteroviruses, HAV, and respiratory viruses of major medical importance including RSV, influenza viruses and parainfluenza viruses. Such a cell strain or line would facilitate the development and production of commercially useful and effective vaccines. There is a pressing need for the development of vaccines against these viruses in order to prevent severe viral diseases of infants, children, adults and the elderly.

Therefore, the availability of a single cell strain or line capable of supporting the efficient replication of those viral agents responsible for a significant number of childhood and adult diseases would provide a significant advancement in the formulation and production of multivalent vaccines.

SUMMARY OF THE INVENTION

The present invention is directed to a cell substrate that substantially overcomes the limitations of previously established cell strains or lines. The serially passaged cells of the present invention are derived from the paired kidneys of an African green monkey and support the efficient growth of medically important human rotaviruses, astroviruses, picornaviruses such as enteroviruses including the Sabin live attenuated poliovirus vaccine strains and hepatitis A virus, and respiratory viruses such as respiratory syncytial virus, parainfluenza viruses, and influenza A and B viruses.

The AGMK cells of the invention are designated as a cell substrate because it is not clear at this time whether they constitute a cell strain or cell line. It is probable that they are a cell line because they are aneuploid, an essential and defining property of cell lines. However, the AGMK cells have been passaged serially only 30 times and assignment of cell immortality, one of the other defining features of a cell line, requires more than 50 serial passages.

At the 30th passage there was no diminution of viability, or ability to grow nor was there any other outward sign of senescence. Furthermore, the AGMK cells have been split 1:4 or 1:8 at each of these passages, a split ratio that is characteristic of cell lines but not cell strains which usually can not be split more than 1:2.

An important advantage of the present invention is that the cell substrate, based on currently promulgated guidelines (i.e., "Points to Consider in the Characterization of Cell Lines Used to Produce Biologicals" (May 1993)) and state-of-the-art testing, has been demonstrated to be free of detectable adventitious microbial agents. This feature allows the cell substrate to be employed for the growth of viruses, such as the human rotaviruses and hepatitis A virus, which have a very highly restricted and narrow tissue culture host range. The unavailability of such a clean cell system prior to this invention has hampered vaccine development for these viruses. In addition, the cell substrate can be used in studies which require cultures of monkey kidney cells free of simian adventitious agents. The commercially available monkey kidney cell cultures are frequently contaminated with these agents, which negate or becloud any results obtained and preclude their use in vaccines destined for administration to humans. This invention also offers the advantage of a cell substrate which can be trypsinized and split in ratios ranging from 1:4 to 1:8 depending upon vessel size and time constraints imposed by vaccine production deadlines.

Additional features and advantages of the invention will be set forth in the description which follows or may be learned by practice of the invention. The objectives and other advantages of the invention to be realized and attained will be cited in the written description and claims hereof as well as the appended drawings.

To achieve these and other advantages and in accordance with the purpose of the invention, as embodied and broadly described, the invention provides a cell line derived from the paired kidneys of an African green monkey, which is free of demonstrable adventitious microbial agents. The invention also provides a method for establishing the cell line by the enzymatic disaggregation of the paired kidneys from an African green monkey and continuous cultivation of the resulting cells. In addition, the invention provides a method for recovering and serially propagating specific viruses in the cell line that subsequently can be used for production of a viral vaccine.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 outlines the passage history from a single ampoule of a disassociated African Green Monkey Kidney sample to the preparation of a Master Seed Cell Bank (MSCB) and a Master Working Cell Bank (MWCB).

FIG. 2 outlines the passage history from single ampoule from the MWCB to post-production history.

FIG. 3 depicts the results of a radioimmunofocus assay of HAV/7 as a fraction of time for plaque formation for 11-1 cell (FRhK-derived cell line) and for AGMK cells.

DETAILED DESCRIPTION OF THE INVENTION

The present invention provides a cell line derived from a pair of African green monkey kidneys. The cell line is free of demonstrable viable adventitious microbial agents. In addition, the cell line is capable of supporting the growth of viruses such as human rotaviruses, astroviruses, enteroviruses, respiratory viruses and hepatitis A and is, therefore, useful for propagating viruses necessary for the production and formulation of a number of effective vaccines on a scale that makes such vaccines commercially feasible.

Specifically, the present invention relates to an aneuploid cell substrate with chromosome counts in the diploid range which was initiated by the enzymatic disaggregation of paired kidneys from a female Cercopithecus African green monkey. A deposit of the cell line at passage No. 13, Lot 6500 has been made with the American Type Culture Collection, 10801 University Boulevard, Manassas, Va. 20110-2209, USA, on Nov. 4th, 1994 and has been assigned accession No. ATCC# CRL 11756.

This cell line was deposited according to the Budapest Treaty. If the deposited culture should die or otherwise become lost or destroyed, this cell line will be replaced with a living culture containing this cell line. This cell line will be maintained for a period of at least 30 years after the date of deposit, and for a period of at least 5 years after the most recent request for a sample. This cell line will be made available if a Patent Office signatory to the Budapest Treaty certifies one's right to receive, or if a U.S. Patent is issued to this application or any other applications claiming benefit of priority to this application.

The present invention also provides a method of establishing a cell substrate capable of at least 30 serial passages that is initially derived by the enzymatic disaggregatior of kidneys from an African green monkey. In addition, the invention provides a method for recovery and growth of specific viruses, a necessary first step for subsequent vaccine production.

It will be apparent to those skilled in the art that various modifications and variations can be made in the cell substrate of the present invention and in its uses without departing from the spirit or scope of the invention. Thus, it is intended that the present invention covers the modifications and variations of this invention provided they come within the scope of the appended claims and their equivalents.

Having now described the invention in general terms, it will be better understood by reference to certain examples which are included herein for the purpose of illustration only and are not intended to be limiting unless otherwise specified.

EXAMPLE 1

Derivation of the AGMK Cell Substrate

Source: The cell substrate was derived from the kidneys of an African green monkey from a colony that had been established on Barbados. The cells are free of any demonstrable viable adventitious microbial agents. The microbial agents include, but are not limited to bacteria, fungi, mycobacteria, mycoplasma and simian agents such as retroviruses, foamy viruses, hemadsorbing viruses, herpes-like viruses and multi-nucleating or syncytial viruses. The kidneys were processed using conventional enzymatic disaggregation technology. The resulting kidney cell suspension was used to initiate 3 primary flask [T150 cm2 ] cultures with the remainder, designated as Freeze #2129, distributed into multiple ampules and frozen for storage in a liquid nitrogen freezer. The primary flask cultures labelled A, B and C, were processed as follows:

Flask A: On day 14 split 1:2=1-A-1 & 1-A-2 with one of these flasks split on day 28 1:2=2-A-1 & 2-A-2

Flask B: On day 21 split 1:2=1-B-1 & 1-B-2 with one of these flasks split on day 35 1:2=2-B-1 & 2-B-2

Flask C: Not split

The maintenance medium consisted of Eagle's Minimal Essential Medium (EMEM) +5% fetal bovine serum (heat inactivated at 56° C. for 30 min.) +1% glutamine (200 mM). All flask cultures were refed with 100 ml of fresh maintenance medium on a weekly basis for a total incubation period of 9 weeks based on the initial planting date. The cultures were negative for hemadsorption and CPE (cytopathic effect), the latter determined by microscopic examination after fixation and staining.

The passage history from a single ampule to the preparation of the Master Seed Cell Bank (MSCB) and the Master Working Cell Bank (MWCB) is depicted in FIG. 1. Cultures were handled in a Class 100 Laminar Flow Hood and in an area where only normal tissue cultures and/or vaccine-designated cell systems were cultured. Cultures were serially passaged employing a 1:4 to 1:6 split ratio with incubation at 36° C.±1° C. and utilizing the following methodology:

1. Cell films were washed with Hanks' Balanced Salt Solution (HBSS) without Ca++ and Mg++.

2. Films were disaggregated by the addition of a trypsin-EDTA solution and incubation at 36° C.+1° C. for 4-5 minutes.

3. Films were broken up by rapid pipetting with the cells suspended in the growth medium [EMEM+10% fetal bovine serum+1% glutamine] and seeded into appropriate size culture vessels.

The passage history from single ampules from the MWCB to the post-production testing is outlined in FIG. 2.

EXAMPLE 2

Testing of the Master Working Cell Bank--Passage 7A, Lot #4214

1. KARYOTYPING AND SPECIES IDENTIFICATION

Passage 7A, Lot #4214 was characterized by Giemsa banded chromosome analysis and reaction with species-specific antisera and isoenzyme analysis.

a. Cytogenic Characterization

Conventional chromosome staining (non-banded) was utilized to determine chromosome count ploidy distribution per 100 metaphases. Identifiable markers and aberrations were analyzed for 50 metaphases.

Chromosome banding by trypsin-Giemsa was utilized to analyze the karyotype and identify specific chromosome markers. Species confirmation was made using G-banding patterns and chromosome morphology. The procedures used were modifications of those described by Peterson, W. D., Jr., Simpson, W. F., and Hukku, B., Cell culture characteristics: Monitoring for cell identification, in Jakoby, W. B. and Pastan, I. H., eds., Methods in Enzymology 58:164-178, 1979; and Seabright, M., A rapid banding technique for human chromosomes, Lancet, ii:971-972, 1971.

The cell line was identified as an aneuploid female Cercopithecus (African green) monkey (XX) with chromosome counts in the diploid range. Most of the chromosomes were normal and present in two copies each. Normal chromosome D was monosomic and a single marker D chromosome was observed.

b. Species Identification of Cell Culture

The ability of the test cell preparation to react with species-specific antisera was determined using the fluorescent antibody technique as described by Peterson et al., supra. The cells reacted with monkey antiserum but not with mouse or hamster antiserum.

c. Isoenzyme Analysis

Enzyme preparations were made from the test article cells. The electrophoretic migration distances of the enzymes were compared with known migration distances of enzymes in various mammalian species as described by Halton, D. M., Peterson, W. D., Jr., and Hukku, B. Cell culture quality control by rapid isoenzymatic characterization, In Vitro 19:16-24, 1983; Ottenbreit, M. J., Halton, D. M., and Peterson, W. D., Jr., Rapid isoenzyme analysis of cell cultures by agarose electrophoresis, I. Interspecies identification, J. Tissue Culture Methods, 6:107-110, 1982; and II. Intraspecies identification of human cell lines, J. Tissue Culture Methods, 8:125-130, 1986.

The electrophoretic mobilities of enzymes glucose-6-phosphate dehydrogenase (G6PD), nucleoside phosphorylase NP), malate dehydrogenase (MDH) and lactate dehydrogenase (LDH) present in an extract prepared from the test cells were comparable to those of a Cercopithecus (African green) monkey control cell preparation. No extra bands were observed on the electrophoresis films that might suggest the presence of cells of a species other than that of the cell culture.

Cells other than those of the submitted culture (MWCB, Passage 7A, Lot# 4214) were not detected in the culture by either isoenzyme analysis or by cytogenic evaluation.

2. DETECTION OF RETROVIRUSES

a. Detection of Retrovirus Particles by Electron Microscopic Examination

A cell pellet of the test article cells (MWCB, Passage 7A, Lot# 4214) was prepared and examined for the presence of virus particles by transmission electron microscopy. No retrovirus-like particles were found in the 200 cells observed.

b. Detection of Retrovirus Reverse Transcriptase in the Presence of DNA-Dependent DNA Polymerase

The test article (MWCB, Passage 7A, Lot# 4214) was analyzed for the presence of types B, C and D retrovirus reverse transcriptase and cellular DNA polymerase activity. No evidence for the presence of retrovirus reverse transcriptase was observed.

The results are presented in Table I-A, B and C.

TABLE I-A ______________________________________ Reverse Transcriptase and DNA Polymerase Activities in Test Article AGMK MWCB Cell Cultures: p7A, L-4214 Adjusted Reverse Transcrip- Reverse DNA tasea Transcriptaseb Polymeraseb (rAdT) (rAdT) (dAdT) Sample Mn++ Mn++ Mn++ Mn++ Mn++ ______________________________________ Test Article Undiluted 22 25 0 7 0 Diluted 2-fold 6 8 0 19 1 in mediumc Diluted 2-fold 20,837 433 10 0 in R-MuLVd Diluted 2-fold in 795 6 7,137 508 DNA polymerasee Positive and Neg- ative Controlsf R-MuLV diluted 18,589 549 12 0 2-fold in mediumg DNA Polymerase 1,079 25 5,443 542 diluted 2-fold in mediumg SMRVh 2,585 48,289 211 396 Stabilization (63) (59) (67) .sup. (58) Bufferi Mediumc (65) (57) (65) .sup. (52) Mediumg (78) (56) (62) .sup. (49) ______________________________________ a Reverse transcriptase activity adjusted for the effect of DNA polymerase (Table 2 and Methods). b Expressed as counts per minute 3 Hthymidine triphosphate incorporated (mean duplicates minus background). c EMEM + 10% serum subtracted from test article samples. d RMuLV (Rauscher Murine Leukemia Virus) Type C virus positive control. e DNA polymerase Positive control; prepared from mink lung cells. f Control monitoring background of incorporation of 3Hthymidine triphosphate (reaction mixture with undiluted test article minus template primers) = 61 cpm (medium background not subtracted). g EMEM + 10% serum subtracted from RMeLV and DNA polymerase positive controls. h SMRV (Squirrel Monkey Retrovirus Preparation) Type D virus positive control. i Stabilization buffer used to dilute SMRV positive control.

TABLE I-B ______________________________________ Adjustment of Reverse Transcriptase Values for Interference by Polymerase in Test Article AGMK MWCB Cell Cultures: p7A, L-4214 DNA Polymerase Assay (CPM) RT Assay (CPM) DNA Observeda Adjustedb Observed Polymerase Test Article (Mn++) (Mn++) (Mn++) × Slope ______________________________________ Undiluted 25 22 37 3 Diluted 2-fold 8 6 19 2 in mediumc ______________________________________ a Unadjusted 3 HTTP incorporation catalyzed by RT. May include effects by cellular DNA polymerase. b Adjusted 3 HTTP incorporation catalyzed by RT = Observed RT (DNA polymerase × Slope). Slope = 0.08. c Medium used to dilute test article.

TABLE I-C ______________________________________ Reverse Transcriptase and DNA Polymerase Activities in a DNA Polymerase Preparation from Reverse Transcriptase-Negative Cell Cultures (Used for Determinig Interference in Reverse Transcriptase Assay by DNA Polymerase) Reverse Transcriptaseb DNA Polymeraseb (rAdT) (dAdT) DNA Polymerasea Mn++ Mg++ Mn++ Mg++ ______________________________________ Sample 1 116 10 1,898 198 Sample 2 187 0 2,634 0 Sample 3 547 6 6,690 119 Sample 4 574 3 8,529 81 Sample 5 1,196 27 14,315 1,222 ______________________________________ a DNA polymerase prepared from mink lung cells. b Expressed as counts per minute 3 Hthymidine triphosphate incorporated [mean duplicates minus background (medium)].

EXAMPLE 3

Post-Production Cell Testing

1. Karyotyping and Species Identification

The AGMK cells at Passage 17A, Lot #4706 were characterized by Giemsa banded chromosome analysis and reaction with species-specific antisera and isoenzyme analysis.

The cells were identified as aneuploid female Cercopithecus (African green) monkey (XX, XXX) with chromosome counts in the hypodiploid to hyperdiploid range. All karyotypes examined contained a single normal Cercopithecus monkey marker chromosome (Group D) and a second partially deleted Cercopithecus monkey D group marker chromosome.

The electrophoretic mobilities of the enzymes G6PD, NP, MDH and LDH present in an extract prepared from the test cells were comparable to those of Cercopithecus (African green) monkey control cell preparation. No extra bands were observed on the electrophoresis films that might suggest the presence of cells of a different species in the cell culture. The cells reacted with monkey antiserum but not with mouse antiserum.

Cells other than those of the submitted culture (Passage 17A, Lot #4706) were not detected in the culture by either antisera reaction, isoenzyme analysis or by cytogenic evaluation. The chromosome pattern was similar to that previously observed for cells in the MWCB, Passage 7A, Lot #4214 and specifically related these cells (Passage 17A, Lot #4706) to the former.

2. Detection of Retroviruses

a. The Test Article, AGMK Passage 17A, Lot #4706

Was analyzed for the presence of types B, C and D retrovirus reverse transcriptase and cellular DNA polymerase activity. The cells were grown in the presence of 30 μg/ml bromodeoxyuridine for 24 hours (day 0 to day 1) and then refed with medium without inducer. Culture fluids (unconcentrated and concentrated 20-fold) were harvested on days 2, 3 and 4. No evidence for the presence of retrovirus reverse transcriptase activity was observed in the test article. The results are presented in Table II-A, B and C.

b. Detection of Retrovirus Particles by Electron Microscopic Examination

Cell pellets were prepared from the treated and untreated cultures harvested on day 4 and examined for the presence of virus particles by transmission electron microscopy. No retrovirus-like particles were found in the 200 cells observed.

c. Detection of Simian T-Lymphotropic Virus (STLV) in Test Article (AGMK, Passage 17A, Lot #4743) by Polymerase Chain Reaction (PCR) Technique

The polymerase chain reaction (PCR) provides a method for detection of extremely low numbers of viral nucleic acid sequences, which would not be detectable without amplification. When coupled with a pre-PCR reverse transcriptase step, RNA sequences may be amplified, thus allowing detection of free virus. The protocol used allowed for the amplification of either DNA or RNA derived STLV-specific sequences. The PCR products were tested by Southern blotting, using chemiluminescent enzyme-linked probe hybridization to the blot.

When tested with the STLV pol primers SK110/SK111, STLV-specific product was not detected in test article reactions, each of which represented 1.0 μg nucleic acid extracted from the test article. In the positive control series, which contained the equivalent of 0.001 μg, 0.01 μg, 0.1 μg or 1 μg of nucleic acid extracted from a cell line infected by STLV (STLVmn103), STLV-specific product was detected in all reactions. On the basis of failure to detect reactivity with STLV primers, the test article was judged to be negative for STLV nucleic acid sequences.

d. Detection of the Simian Immunodeficiency Virus in Test Article (AGMK, Passage 18A, Lot #5506)

Total cellular DNA was extracted from the test article and subsequently tested for the presence of SIVagm virus sequences using primers that amplify a 200 bp fragment of the LTR. This involved PCR with nested sets of primers as follows:

Outer set #1807 F: CCTCAGAGCTGCATAAAAGCAGAT (SEQ ID NO:1) - #1808 R: TCACTCAAGTCCCTGTTCGGGCGC (SEQ ID NO:2) - Inner set #1809 F: TACTAGGAGACCAGCTTGAGCCTG (SEQ ID NO:3) - #1810 R: TGCTGGAGTTTCTCTCGCCTGGGT (SEQ ID NO:4)

These primers were designed for the conserved U5 and R regions of the LTR and are capable of amplifying all subtypes of SIVagm. The predicted 200 bp fragment was amplified from DNA extracted from a chronically-SIVagm infected cell line (SIVagm 155CEMss) but the African green monkey cells did not have detectable SIVagm sequences by Southern blot analysis.

3. Tumorigenicity in Athymic Nude Mice

The cells were found to be non-tumorigenic after being clinically evaluated for 150 days. Athymic nude mice were inoculated subcutaneously with approximately 1×107 test article cells (AGMK Passage 17A, Lot #4889). Athymic nude mice were similarly inoculated with positive control cells. All 10 positive control inoculated mice had tumors at the site of inoculation. No metastases were observed in the inoculation site (skin), lung, lymph nodes, liver, kidney, spleen or brain of mice inoculated with the test article.

TABLE II-A ______________________________________ Reverse Transcriptase and DNA Polymerase Activities in Unconcentrated AGMK Passage 17A, Lot #4706 Reverse Trans- DNA Poly- criptasea merasea Sample (rAdT) (dAdT) Test Article Cellsb Mn++ Mg++ Mn++ Mg++ ______________________________________ DAY 2 Untreated 0 0 227 0 Treated 29 0 485 85 3 Untreated 0 0 265 6 Treated 0 0 243 0 4 Untreated 35 0 711 29 Treated 48 0 723 26 ______________________________________ a Expressed as counts per minute 3 Hthymidine triphosphate incorporated (mean duplicates minus background). b Culture fluids from test article cells.

TABLE II-B ______________________________________ Reverse Transcriptase and DNA Polymerase Activities in AGMK Passage 17A, Lot #4706 Concentrated 20-fold Reverse Trans- DNA Poly- criptasea merasea Sample (rAdT) (dAdT) Test Article Cellsb Mn++ Mg++ Mn++ Mg++ ______________________________________ DAY 2 Untreated 9 0 18 87 Treated 0 0 15 104 3 Untreated 6 0 32 125 Treated 9 3 19 136 4 Untreated 22 3 14 114 Treated 122 2 2,423 516 ______________________________________ a Expressed as counts per minute 3 Hthymidine triphosphate incorporated (mean duplicates minus background). b Culture fluids from test article cells.

TABLE II-C ______________________________________ Reverse Transcriptase and DNA Polymerase Activities in AGMK Passage 17A, Lot #4706 Sample Reverse Transcriptasea DNA Polymerasea Positive and Negative (rAdT) (dAdT) Controls Mn++ Mg++ Mn++ Mg++ ______________________________________ R-MuLVc 65,913 2,230 0 16 SMRVd 12,031 133,798 1,274 2,825 DNA Polymerasee 7,015 57 60,197 6,646 Mediumf (163) (74) (242) (107) Stabilization Bufferg (53) (59) (46) (44) Mediumh (146) (136) (321) (148) ______________________________________ a Expressed as counts per minute 3 Hthymidine triphosphate incorporated (mean duplicates minus background). b Culture fluids from test article cells. c RMuLV (Rauscher murine leukemia virus) Type C virus positive control. d SMRV (Squirrel Monkey Retrovirus Preparation) Type D virus positive control. e DNA polymerase Positive control; prepared from mink lung cells. f Medium Subtracted from unconcentrated, untreated and treated samples. g Stabilization buffer Negative control; subtracted from positive controls and concentrated samples. h Medium Subtracted from RMulV and DNA polymerase positive controls

EXAMPLE 4

Post-Production Testing for Microbial Sterility

1. Bacterial Sterility in Fluid Thioglycollate Medium

Each of 10 culture tubes (9-10 ml medium per tube) was inoculated with 1.0 ml of the AGMK cell suspension (Passage 17A, Lot #4706) containing approx. 5×105 cells per ml. Each of 5 tubes was inoculated with 1.0 ml of the original growth medium. Ten cultures were included as uninoculated controls. All cultures were vortex mixed and incubated at 32° C.±2° C. for 21 days with observations made on days 1, 3, 6, 8, 10, 13, 15, 17, 20 and 21. No growth was observed in any of the 25 cultures.

2. Fungal Sterility in Soybean Casein Digest Medium

Each of 10 culture tubes (9-10 ml medium per tube) was inoculated with 1.0 ml of the AGMK cell suspension (Passage 17A, Lot #4706) containing approx. 5×105 cells per ml. Each of 5 tubes was inoculated with 1.0 ml of the original growth medium. Ten cultures were included as uninoculated controls. All cultures were vortex mixed and incubated at 22° C.±2° C. for 21 days with observations made on days 1, 3, 6, 8, 10, 13, 15, 17, 20 and 21. No growth was observed in any of the 25 cultures.

3. Mycobacterial Sterility in Lowenstein-Jensen Egg Medium

Each of 10 slant culture tubes was inoculated with 0.5 ml of the AGMK cell suspension (Passage 17A, Lot #4706) containing approx. 5×105 cells per ml. Each of 10 culture slants was inoculated with 0.5 ml of the original growth medium. Six cultures were included as uninoculated controls. All cultures were incubated at 36° C.±1° C. horizontally for the first 24 hours and vertically for the remainder of the 8 week observation period with weekly observations for growth. On day 28, one cell suspension inoculated culture was found contaminated with a mold. No growth was observed in any of the remaining 25 cultures after 8 weeks.

This assay was repeated with AGMK Passage 18A, Lot #4918, but using 6 culture slants inoculated with the original growth medium. No growth was observed in any of the 22 cultures after 8 weeks. The results of the above Microbial Sterility Assays are summarized in Table III.

4. Mycoplasma Sterility

The assay for mycoplasma was performed using both the direct Broth Enrichment and Agar Procedures and the indirect Indicator Cell Culture Procedure with the AGMK cell suspension (Passage 17A, Lot #4706) containing approximately 5×105 cells per ml. The cell suspension was found to be negative for mycoplasmas by all procedures.

TABLE III __________________________________________________________________________ Microbial Sterility Test Results on the AGMK Cell Suspension - Passage 17A, Lot #4706 and #4918 at Approximately 5 × 105 Cells/ml Vol. Per. Culture Date Culture Medium No. (ml) Temp. On Test Off Test Results __________________________________________________________________________ Fluid Thioglycollate (FIM) LOT VVPL #122-50 10 -- 32° C. 1/05/93 1/26/93 No Growth Cell Suspension #4706 10 1.0 (±2.degr ee. C.) | | No Growth Culture Medium 5 1.0 1/05/93 1/26/93 No Growth Soybean-Casein-Digest (SCDM) LOT VVPL #112-51 10 -- 22° C. 1/05/93 1/26/93 No Growth Cell Suspension #4706 10 1.0 (±2.degr ee. C.) | | No Growth Culture Medium 5 1.0 1/05/93 1/26/93 No Growth Lowenstein-Jensen Egg Medium - LOT #C3CPPB 6 -- 36° C. 1/05/93 3/02/93 No Growth Cell Suspension #4706 10 0.5 (±1.degr ee. C.) | | 1/10 mold | | on day 28 Culture Medium 10 0.5 1/05/93 3/02/93 No Growth Lowenstein-Jensen Egg Medium - LOT #H3CTGX 6 -- 36° C. 2/23/93 4/20/93 No Growth Cell Suspension #4918 10 0.5 (±1.degr ee. C.) | | No Growth Culture Medium 6 0.5 2/23/93 4/20/93 No Growth __________________________________________________________________________

EXAMPLE 5

In Vitro Tissue Culture Purity and Safety Tests for the Detection of Viable Adventitious Microbial Agents

These assays were performed in roller tube cultures of the following tissue culture systems: Serially passaged African green monkey kidney (AGMK); Primary Human Amnion (PHA); Vero; Primary Rabbit Kidney (PRK); Whole Human Embryo Fibroblast (Fl 5000); and Human Carcinoma of the Larynx (H.Ep-2). Cultures were maintained on Medium EMEM containing 2-10% fetal bovine serum (gamma irradiated) plus antibiotics: gentamicin, 100 μg/ml; neomycin, 50 μg/ml; and fungizone, 2.5 μg/ml. Cultures were refed with 2 ml of maintenance medium prior to inoculation.

Testing Procedures

The cell suspensions (Lots #4742/3, #4755 or #4889 containing approximately 5×105 cells per ml) were inoculated in 0.5 ml amount per each of 28 roller tubes per tissue culture system. Cultures were incubated at 36° C.±1° C. for 14 days with periodic microscopic examination for any cytopathic effect (CPE) and/or cellular degeneration. When necessary to maintain the integrity of the cell films, cultures were refed with 2 ml of fresh maintenance medium. Additional groups of 28 roller tubes per tissue culture system were included as uninoculated controls.

On the 7th-8th day of incubation, 6-9 tubes from each series (inoculated and controls) were removed and tested for hemadsorption with 3 red blood cell (RBC) suspensions (guinea pig at 0.1%, chicken at 0.075%, or human at 0.1% in PBS, pH 7.2). Films were rinsed once in the phosphate-buffered saline (PBS) prior to the addition of 1 ml of the RBC suspension employing 2-3 tubes per RBC. Initially, tubes were incubated at 2°-8° C. for a minimum of 30 minutes and examined microscopically for any signs of hemadsorption. Following manual shaking, tubes were incubated at 35°-37° C. for a minimum of 30 minutes and re-examined microscopically for hemadsorption. All cultures were inactive for hemadsorption with all 3 suspensions and at both temperatures. On day 14, after final microscopic examination, the cultures were divided, depending on the specific tissue culture system for final testing. AGMK, PHA and Fl5000 Tube Cultures were divided as follows:

1. 9 tubes from each series were tested for hemadsorption with the 3RBC suspensions as described above for day 7-8;

2. 4 tubes from each series were fixed and stained with a solution of 5% glutaraldehyde +0.025% crystal violet and, after drying, examined microscopically for any signs of CPE;

3. 8 tubes from each series were challenged with Coxsackie A-9 virus (0.1 ml for each of 2 tubes using a 10-2, 10-3, 10-4 or 10-5 dilution) for the detection of non-CPE producing agents and/or latent agents via the interference phenomenon; and

4. One (1) tube of each series was included as an uninoculated control for the challenge virus.

Vero, PRK and H.Ep-2 Tube Cultures were divided as follows:

1. 12 tubes from each series were tested for hemadsorption with the 3 RBC suspensions as described above for day 7-8;

2. 7 tubes from each series were fixed and stained with a solution of 5% glutaraldehyde +0.025% crystal violet and, after drying, examined microscopically for any signs of CPE.

No challenge studies were carried out with the Coxsackie A-9 virus as this agent does not produce any discernible CPE in these cell systems. The results of these in vitro tissue culture purity and safety assays are summarized in Tables IV-A to F.

TABLE IV-A ______________________________________ Tissue Culture Purity Tests on the AGMK Cell Suspension - Passage 17A, LOT #4742/3 at Approximately 5 × 105 Cells/ml African Green Monkey Kidney Cells - Passage 12, LOT #4793) Day 7 Results Day 14 Results AGMK Controls AGMK Controls ______________________________________ 0.1% Guinea Pig RBC at 2°-8° C. 0/2 0/2 0/3 0/3 at 35°-37° C. 0/2 0/2 0/3 0/3 0.075% Chicken RBC at 2°-8° C. 0/2 0/2 0/3 0/3 at 35°-37° C. 0/2 0/2 0/3 0/3 0.1% Human RBC at 2°-8° C. 0/2 0/2 0/3 0/3 at 35°-37° C. 0/2 0/2 0/3 0/3 Giemsa Stain 0/4 0/4 Coxsackie A-9 Virus Challenge* at 10-3 2/2 2/2 10-4 2/2 2/2 10-5 2/2 2/2 10-6 2/2 2/2 Unchallenged Controls 0/1 0/1 ______________________________________ *Coxsackie A9 Challenge results based on a 5day incubation at 36° C. Prior to challenge, tubes refed with 2 ml of fresh medium.

TABLE IV-B ______________________________________ Tissue Culture Purity Tests on the AGMK Cell Suspension - Passage 17A, LOT #4742/3 at Approximately 5 × 105 Cells/ml Primary Human Amnion - (PHA) - (LOT #4720) Day 7 Results Day 14 Results AGMK Controls AGMK Controls ______________________________________ 0.1% Guinea Pig RBC at 2°-8° C. 0/2 0/2 0/3 0/3 at 35°-37° C. 0/2 0/2 0/3 0/3 0.075% Chicken RBC at 2°-8° C. 0/2 0/2 0/3 0/3 at 35°-37° C. 0/2 0/2 0/3 0/3 0.1% Human RBC at 2°-8° C. 0/2 0/2 0/3 0/3 at 35°-37° C. 0/2 0/2 0/3 0/3 Giemsa Stain 0/4 0/4 Coxsackie A-9 Virus Challenge* at 10-3 2/2 2/2 10-4 2/2 2/2 10-5 2/2 2/2 10-6 2/2 2/2 Unchallenged Controls 0/1 0/1 ______________________________________ *Coxsackie A9 Challenge results based on a 5day incubation at 36° C. Prior to challenge, tubes refed with 2 ml of fresh medium.

TABLE IV-C ______________________________________ Tissue Culture Purity Tests on the AGMK Cell Suspension - Passage 17A, LOT #4755 at Approximately 5 × 105 Cells/ml Vero Cells - (Passage 143, LOT #4813) Day 7 Results Day 14 Results AGMK Controls AGMK Controls ______________________________________ 00.1% Guinea Pig RBC at 2°-8° C. 0/3 0/3 0/4 0/4 at 35°-37° C. 0/3 0/3 0/4 0/4 0.075% Chicken RBC at 2°-8° C. 0/3 0/3 0/4 0/4 at 35°-37° C. 0/3 0/3 0/4 0/4 0.1% Human RBC at 2°-8° C. 0/3 0/3 0/4 0/4 at 35°-37° C. 0/3 0/3 0/4 0/4 Giemsa Stain 0/7 0/7 ______________________________________

TABLE IV-D ______________________________________ Tissue Culture Purity Tests on the AGMK Cell Suspension - Passage 17A, LOT #4889 at Approximately 5 × 105 Cells/ml Rabbit Kidney Cells - (Primary, LOT #4814) Day 7 Results Day 14 Results* AGMK Controls AGMK Controls ______________________________________ 0.1% Guinea Pig RBC at 2°-8° C. 0/4 0/4 0/3 0/3 at 35°-37° C. 0/4 0/4 0/3 0/3 0.075% Chicken RBC at 2°-8° C. 0/4 0/4 0/3 0/3 at 35°-37° C. 0/4 0/4 0/3 0/3 0.1% Human RBC at 2°-8° C. 0/4 0/4 0/3 0/3 at 35°-37° C. 0/4 0/4 0/3 0/3 Giemsa Stain 0/7 0/7 ______________________________________ *On day 8, tubes refed with 2 ml of fresh medium.

TABLE IV-E ______________________________________ Tissue Culture Purity Tests on the AGMK Cell Suspension - Passage 17A, LOT #4889 at Approximately 5 × 105 Cells/ml Whole Human Embryo Fibroblast Cells - (FL 5000) - (Passage 22, LOT #4842) Day 7 Results Day 14 Results AGMK Controls AGMK Controls ______________________________________ 0.1% Guinea Pig RBC at 2°-8° C. 0/2 0/2 0/2 0/2 at 35°-37° C. 0/2 0/2 0/2 0/2 0.075% Chicken RBC at 2°-8° C. 0/2 0/2 0/2 0/2 at 35°-37° C. 0/2 0/2 0/2 0/2 0.1% Human RBC at 2°-8° C. 0/2 0/2 0/2 0/2 at 35°-37° C. 0/2 0/2 0/2 0/2 Giemsa Stain 0/4 0/4 Coxsackie A-9 Virus Challenge* at 10-3 2/2 2/2 10-4 2/2 2/2 10-5 2/2 2/2 10-6 1/2 1/2 Unchallenged Controls 0/1 0/1 ______________________________________ *Coxsackie A9 Challenge results based on a 4day incubation at 36° C. Prior to challenge, tubes refed with 2 ml of fresh medium.

TABLE IV-F ______________________________________ Tissue Culture Purity Tests on the AGMK Cell Suspension - Passage 17A, LOT #4755 at Approximately 5 × 105 Cells/ml Human Carcinoma of the Larynx - H.Ep-2 - (Passage 397, LOT #4808) Day 7 Results Day 14 Results AGMK Controls AGMK Controls ______________________________________ 0.1% Guinea Pig RBC at 2°-8° C. 0/3 0/3 0/4 0/4 at 35°-37° C. 0/3 0/3 0/4 0/4 0.075% Chicken RBC at 2°-8° C. 0/3 0/3 0/4 0/4 at 35°-37° C. 0/3 0/3 0/4 0/4 0.1% Human RBC at 2°-8° C. 0/3 0/3 0/4 0/4 at 35°-37° C. 0/3 0/3 0/4 0/4 Giemsa Stain 0/7 0/7 ______________________________________ *On day 10, tubes refed with 2 ml of fresh medium.

EXAMPLE 6

In Vivo Tests for the Detection of Viable Adventitious Microbial Agents

The following tests were performed employing cell suspensions derived from Passage 17A-(Lots #4706, #4742, #4755 and #4788). These assays were performed with inocula consisting of approximately 1×107 cells per ml suspended in the culture medium in which they were grown.

1. Tests in Animals

a. Suckling Mouse Assay

A total of 10 newborn CD-1 mice randomized from different litters (10 per mother, less than 24 hours old) were inoculated intracerebrally (I.Cer.) with 0.01 ml and intraperitoneally (I.P.) with 0.1 ml of the cell suspension from Lot #4706. An additional randomized group of 10 sucklings was inoculated in a similar manner with the original culture medium. A randomized group of 10 sucklings was included as uninoculated controls. All sucklings were observed daily for 14 days for deaths and/or signs of illness or distress. On day 2, one (1) suckling from each of the inoculated groups was found missing and presumed cannibalized. There were no other deaths and none of the sucklings exhibited any signs of illness or distress over this initial 14 day observation period.

On the 14th day, single pools were prepared of the emulsified tissue (minus skin and viscera) of the following groups: (a) AGMK inoculated pups (n=9); (b) culture fluid inoculated pups (n=9); and © uninoculated controls (n=10). A blind.passage into newborn CD-1 mice was made of each pool via the I.Cer. and I.P. routes: each pool into 10 newborns from mixed litters. An additional litter of 10 sucklings was included as uninoculated controls for this blind passage. All sucklings were observed daily for 14 days for deaths and/or signs of illness or distress. There were no deaths recorded for the AGMK or culture medium inoculated pups or for the uninoculated control group; however, on day 3, 4 sucklings were missing and presumed cannibalized in © the passaged control group. None of the sucklings exhibited any signs of illness or distress over this final 14 day observation period.

Because none of the AGMK cell suspension or culture medium inoculated sucklings exhibited any signs of a transmissible agent or of Coxsackie virus infection or of any viral infection, and because >90% of these inoculated sucklings (19 of 20) remained healthy and survived the entire observation period, this assay in suckling mice was considered satisfactory.

b. Adult Mouse Assay

Each of 20 adult CD-1 mice (VAF, 15-20 grams each) was inoculated I.Cer. and I.P. with 0.03 ml and 0.5 ml, respectively, with the cell suspension Lot #4788. An additional 5 mice were inoculated in a similar manner with the original culture medium. Four mice were included as uninoculated controls. Mice were observed daily for deaths and/or signs of illness or distress over a 21 day period. There were no deaths recorded and all mice survived the entire 21 day observation period with no evidence of lymphocytic choriomeningitis virus infection or any other viral infection. This test in adult mice was considered satisfactory.

c. Adult Guinea Pig Assay

Each of 5 Hartley strain guinea pigs (VAF, 350-450 grams each] was inoculated I.Cer. and I.P. with 0.1 ml and 5.0 ml, respectively, with the cell suspension Lot #4755. An additional guinea pig was inoculated in a similar manner with the original culture medium. One (1) guinea pig was included as an uninoculated control. All were observed daily for deaths and/or signs of illness or distress over a 6 week period; none were recorded. Commencing on day 21, daily rectal temperatures were taken with a digital thermometer and recorded (at approximately 0900 hours) for all guinea pigs until time of sacrifice. The average temperatures (° C.) for the AGMK inoculated guinea pigs were: 39.26, 39.30, 39.40, 39.46 and 39.53; for the medium inoculated guinea pig: 39.32; and for the control: 39.37. There were no significant temperature rises indicative of either bacterial or viral infection. All guinea pigs appeared healthy and survived the entire 42-day observation period at which time they were necropsied following euthanasia with Halothane and exsanguination. Inspection of the abdominal and thoracic cavities by the consulting veterinarian did not identify gross lesions or pathological changes. This assay in adult guinea pigs was considered satisfactory.

d. Adult Rabbit Assay

Each of 5 New Zealand white rabbits (1500-2500 gm each) was inoculated intradermally (I.D.) with 0.1 ml per each of 10 sites and subcutaneously (S.Q.) with 9.0 ml of the AGMK cell suspension Lot #4788. One (1) rabbit was similarly inoculated with the original culture medium. One (1) rabbit was included as an uninoculated control. Animals were observed daily for 28 days for deaths, illness, distress and/or lesions at the sites of inoculation. No deaths were recorded and all rabbits remained healthy without exhibiting any signs of illness or distress or lesions at the sites of inoculation. This test in adult rabbits was considered satisfactory. The results of these in vivo animal safety tests are summarized in Table V-A and B.

2. Tests in Embryonated Eggs

For these studies, specific pathogen-free embryonated eggs were obtained from SPAFAS, Inc., Reinholds, Pa. These eggs came from Flock L061-E.

a. Allantoic Inoculation

Each of ten 10-day old embryonated eggs was inoculated via the allantoic route with 0.5 ml of the AGMK suspension Lot #4706. An additional 5 eggs were inoculated in a similar manner with the original culture medium. Five (5) eggs were included as uninoculated controls. Eggs were incubated at 36° C.±1° C. for 72 hours and then candled for deaths (1 of 5 medium inoculated) and chilled overnight at 2°-8° C. Allantoic fluids were harvested individually, incubated in a 37° C. water bath for 60 minutes to elute any adsorbed agent(s), and then clarified by centrifugation at 2500 rpm for 15 minutes at 20° C. Pools were prepared for each of the 3 sets of eggs employing equal volumes from each individual harvest. The pools were assayed for hemagglutination both undiluted and at a 1:10 dilution with incubation at 2°-8° C. and at room temperature (15°-30° C.) using the following erythrocytes in PBS at (pH 7.2): guinea pig at 0.6%; chick at 0.4%; and human at 0.6%. All fluids were negative for hemagglutination at both dilutions and at both temperatures with all 3 RBC suspensions.

The sample pools were subpassaged in 0.5 ml amounts into 10-day old embryonated eggs via the allantoic route as follows: the pool from the AGMK cell suspension into 10 eggs; the pool from the medium into 5 eggs; and the pool from the uninoculated eggs into 5 eggs. An additional 5 eggs were included as uninoculated controls. Eggs were incubated at 36° C.±1° C. for 72 hours and then candled for deaths (none recorded) and chilled overnight at 2°-8° C. Allantoic fluids were harvested, handled and tested as described above. All 4 pools were negative for hemagglutination at both dilutions and at both temperatures with all 3 RBC suspensions.

There were no deaths recorded for any of the eggs inoculated with the AGMK cell suspension. Since none of the harvest fluids exhibited any hemagglutination when tested against guinea pig, chick or human RBC, this aspect of the embryonated egg study was considered satisfactory.

b. Yolk Sac Inoculation

Each of ten 6-day old embryonated eggs was inoculated into the yolk sac with 0.5 ml of the AGMK cell suspension Lot #4742. Five (5) eggs were similarly inoculated with the original culture medium and 5 eggs were included as uninoculated controls. Eggs were incubated at 36° C. [±1° C.] for 9 days with periodic candling for deaths. Of the medium-inoculated eggs, 2 were found dead (1 each on days 2 & 5); and, of the AGMK-inoculated eggs, 2 were inadvertently broken. No other deaths or losses were recorded. Each group of yolk sacs (AGMK group=8; medium group=3; controls=5) was harvested, pooled, washed in PBS, emulsified by grinding and clarified by centrifugation at 2500 rpm for 20 minutes at 20° C.

The 3 clarified suspensions were subpassaged via the same route into fresh 6-day old embryonated eggs as follows: AGMK group into 10 eggs; medium group into 5 eggs; control group into 5 eggs. An additional 5 eggs were included as uninoculated controls. All eggs were incubated at 36° C.±1° C. for 9 days with periodic candling for deaths. On day 7, 3 eggs were found dead; 2 from the AGMK group and 1 from the medium group. There were no other deaths recorded.

This aspect of the embryonated egg study was considered satisfactory, because there was a greater than 80% overall survival (16 of 18) of embryonated eggs (primary and subpassage) inoculated with the AGMK cell suspension and viability of the egg was confirmed.

EXAMPLE 7

Use of the Characterized AGMK Cell Substrate for: (1) Isolation and Growth of Human Rotaviruses: and (2) Production of Live Vaccines Containing Such Viruses

The AGMK cells are the only characterized cells tested to date that are suitable for vaccine purposes and support the efficient growth of completely homologous human rotaviruses, i.e., rotaviruses that derive each of their 11 gene segments from a human rotavirus. This is particularly important because a number of candidate homologous human rotavirus vaccine strains are now under development, including those shown in Table V.

As seen in Table V, two candidate human vaccine rotaviruses of G serotype 1 or G serotype 3 recovered from newborn infants were observed to grow to moderately high or high titer in AGMK cells, whereas, each of these neonatal rotavirus strains was markedly restricted in its capacity to grow in two types of cells certified for vaccine production, i.e., FRhL2 or Vero cells. In addition, one of these neonatal rotavirus strains was also markedly restricted in replicative capacity in human fetal fibroblast cell strain MRC-5 which is licensed for vaccine production.

Similar observations were made with two cold-adapted (ca) mutants of human rotavirus of G serotype 1 or G serotype 2 that are also promising candidate live virus vaccine strains. Both human rotavirus mutants grew efficiently in AGMK cells but were significantly or markedly restricted in their growth in certified cells FRhL2 and Vero.

A. Isolation and Serial Passage of Neonatal Human Rotavirus Strains

Initially, the toxicity of each new preparation of purified trypsin is determined for the AGMK cells to be tested. A known positive stool extract is pre-treated with antibiotics (200 μg/ml gentamicin; 100 μg/ml neomycin; and 5 μg/ml fungizone) for 60 minutes at room temperature. Equal volumes of stool extract and trypsin at pre-determined concentration, e.g., 10 μg/ml, are mixed and allowed to incubate at 37° C. in a water bath for 30 minutes. In the interim, the cultures to be inoculated are washed three times with appropriate volumes (e.g., 3 ml for roller tubes, 10 ml for T25 flasks, 30 ml for T75 flasks and 100 ml T175 flasks) of serum-free medium to dilute the serum that had been in the growth medium in order to prevent components of serum from inactivating trypsin activity.

Roller tube cultures are inoculated with a 0.5 ml volume of the stool/trypsin mixture which is allowed to adsorb at 36° C.±1° C. for 60 minutes while rotating on a roller drum apparatus. Cultures are washed once and fed with 3 ml volumes of (EMEM) containing 1% of 10× SPG (sucrose, 2.18M; KH2 PO4, 0.038M; K2 HPO4, 0.072M; and mono-sodium glutamate, 0.054M) and 1 μg/ml trypsin. Cell cultures in which trypsin is omitted are also included to control for the effect of trypsin. Incubation is at 36° C.±1° C.

Cultures are examined microscopically on a daily basis and cultures are harvested when cytopathic effect (CPE) that involves 75 to 100% of the cells is evident. Virus and control cultures are treated similarly with 10% of 10× SPG (v/v) and subjected to one freeze-thaw cycle prior to harvest, sterility testing, distribution for storage, and serial passage. All subsequent passages are carried out either in roller tube cultures or in 25 cm2 flask cultures employing similar procedures but with variation in trypsin concentration in both pre-treatment and in the final overlay.

An efficient system for producing virus plaques in AGMK cells is developed using methods that are routine in the art so that the virus can be plaque purified in order to obtain a homogeneous population of virus for subsequent vaccine development. The harvest fluids are routinely titrated in the simian MA-104 cells to measure the virus yield obtained. The virus is then triply-plaque-purified AGMK cells and the resulting clone is amplified by serial passage in progressively larger tissue culture vessels. The conditions for maximum yield based on trypsin concentration employed in both pre-treatment and final overlay is determined for the progeny of the isolated clone using methods well known in the art.

B. Adaptation and Serial Passage Human Neonatal Rotaviruses or Other Human Rotavirus Strains

The human rotaviruses exhibit a very narrow tissue culture host range. As a consequence, isolation and serial passage of various strains are usually performed in commercially available laboratory cell cultures such as simian MA-104 or primary monkey kidney, both of which are unsuitable for vaccine production. The former cells have not been validated as a substrate for vaccine production and the latter cells are notorious for their contamination with various simian microbial agents including retroviruses. In contrast to MA104 or primary monkey kidney cells, cell substrates certified for vaccine production, such as simian FRhL-2 or Vero cells, either fail to support growth of completely homologous human rotaviruses or allow only poor growth.

Many well characterized rotaviruses have been isolated, serially passaged and triply plaque-purified in commercially available laboratory cell culture systems not suitable for vaccine production. In those instances where it was necessary to use such viruses in vaccine development, the viruses were subsequently passaged and biologically cloned in a cell substrate certified for vaccine development and production. Ideally, virus to be used in vaccines should be isolated and passaged only in tissue culture cells certified to be acceptable for vaccine production. The AGMK cells of this invention meet this requirement because they support efficient growth of fully homologous human rotaviruses (Table V).

To develop a vaccine, routine studies are performed in flask cultures to determine the conditions for maximum yield including trypsin concentration required in both pre-treatment and final overlay. Once adaptation of the vaccine virus to the AGMK cell substrate has been achieved, the virus harvest is treated with ether (1 part ether to 4 parts virus suspension for 60 minutes at room temperature followed by a 30 minute bubbling with N2 to drive off ether) to eliminate any ether-sensitive virus(es) that may have been present in the original clinical specimen or acquired subsequently during passage in cell culture prior to initiation of vaccine development.

Live Virus Vaccine and/or Suspension Production

To produce vaccine, it is preferable also to prepare several backup pools of virus as fellows:

1. Primary Seed Virus Pool

A pool of virus and serially passaged tissue culture control fluids supplemented with 10% of 10× SPG (v/v) are prepared and, after sterility is confirmed, and potency is determined, the fluids are distributed into small aliquots for storage at or below -70° C. to serve as 3rd level back-up to final vaccine production. Total volume may range from 30 ml to 100 ml.

2. Secondary Seed Virus Pool

A pool of virus and serially passaged tissue culture control fluids supplemented with 10% of 10× SPG (v/v) is prepared. After sterility is confirmed, and potency determined, the fluids are distributed into small aliquots for storage at or below -70° C. to serve as 2nd level back-up to final vaccine production. Total volume may range from 100 ml to 300 ml.

3. Master Seed Virus Pool or Pre-Production Seed Virus Pool

A pool of virus and serially passaged tissue culture control fluids supplemented with 10% of 10× SPG (v/v) is prepared. After sterility is confirmed, potency is determined, and identity is confirmed by both serology and electrophoretic pattern, the fluids are distributed into multi-sized aliquots with storage at or below -70° C. These pools serve as first level back-up to final production. These fluids are subjected to the Tissue Culture Purity (Safety) Testing simultaneously with the vaccine lot. Total volume may range from 500 ml to 1 liter.

4. Live Virus Vaccine Production

Volume to be produced is based on the number of doses and containers required plus a minimum of 400 ml of crude fluid for safety testing. In addition to the virus pool, the production of a small pool (200-400 ml) of the passaged tissue culture control fluid is recommended for subsequent safety testing together with the crude virus harvest. Culture vessel fluids supplemented with 10% of 10× SPG (vly) are subjected to one (1) freeze-thaw cycle prior to individual harvest and sterility testing. A sample pool is prepared and assayed for potency. Identity is confirmed by both serology and electrophoretic pattern. The individual harvests are stored at ...
"The philosophers have only interpreted the world, in various ways. The point, however, is to change it." Karl Marx

"He would, wouldn't he?" Mandy Rice-Davies. When asked in court whether she knew that Lord Astor had denied having sex with her.

“I think it would be a good idea” Ghandi, when asked about Western Civilisation.
Reply
#72
Roll-up your arm and bend over.
"Let me issue and control a nation's money and I care not who writes the laws. - Mayer Rothschild
"Civil disobedience is not our problem. Our problem is civil obedience! People are obedient in the face of poverty, starvation, stupidity, war, and cruelty. Our problem is that grand thieves are running the country. That's our problem!" - Howard Zinn
"If there is no struggle there is no progress. Power concedes nothing without a demand. It never did and never will" - Frederick Douglass
Reply
#73
Quote:Ministers plan swine flu vaccination in every school

Biggest mass immunisation in 45 years would cover all 8.5m pupils

Denis Campbell and James Sturcke guardian.co.uk, Thursday 6 August 2009

All 8.5 million pupils in the UK would be immunised against swine flu at immunisation posts in every school, under plans being studied by ministers, the Guardian has learned.

In the biggest mass vaccination since the 1964 operation against smallpox, school nurses, health visitors and GPs would deliver the injections to five- to 16-year-olds at all 33,700 schools. The move would be part of a concerted government effort to minimise the harm caused by the expected second wave of the pandemic this autumn.

"The general principle of schools being the ideal, logical place to do this is well established. They have captive audiences," said one senior source involved in Whitehall planning.

While written parental approval would be necessary, high demand is expected, as long as the vaccine has been declared to be safe. However, the huge scale of the task has led to questions about whether there would be enough health professionals available to administer the jabs. For example, there are just 1,447 school nurses for the 25,000 schools in England.

The move comes as fresh doubts about the government's H1N1 preparedness timetable were raised yesterday when the World Health Organisation said that a clinically tested flu vaccine would not be ready this month, contrary to ministerial assurances.

Dr Marie-Paule Kieny, director of the WHO vaccine research initiative, said results from clinical tests on a new vaccine were not expected until September. Vaccines would then require regulatory clearance before being given to patients in Europe.

Her remarks cast serious doubt on a number of statements by the health secretary, Andy Burnham, and the chief medical officer, Sir Liam Donaldson, who have said the vaccine will be available this month. A Department of Health spokeswoman said: "The manufacturers have told us that we can expect the first supplies of the vaccine from Baxter in August and from GlaxoSmithKline later in September. This is not the DH's schedule – it is led by the manufacturers." But GSK admitted that it has yet to start clinical trials on people. "We are still at the discussion stage and are not putting a date on when clinical tests will start," a spokesman said.

The first wave of the pandemic appears to be on its way out. The number of new cases of swine flu in England and Scotland has fallen significantly, according to figures released by the Health Protection Agency yesterday. England recorded an estimated 30,000 new cases last week, down from 110,000 the week before, and in Scotland the estimated number of new cases fell from 1,500 to 1,050. Nine more people in England have died, taking the death toll to 36. Donaldson warned against complacency and said he was "pretty certain" of a second wave in the autumn.

The vulnerability of children to the H1N1 virus, the need to keep the pressure off family doctors' surgeries, and easy access to so many young people means schools are likely to be used. Vaccinating a primary school might take several hours but a secondary school several days.

Experts believe the second wave may start building up in England once schools return in September. But inoculation of pupils could not start until large supplies of the vaccine are available – which would be the start of October at the earliest, say health department sources. They also say that under-fives, another priority group, will be immunised at GPs' surgeries.

The Department of Health said last night that the exact form of the immunisation strategy has not yet been agreed. "We have not said that schools will deliver the vaccination programme for swine flu. Decisions have not been made on how the vaccine programme will be delivered, and the chief medical officer has said that he expects GPs to be the bedrock of the programme," the spokeswoman said.

http://www.guardian.co.uk/world/2009/aug...lu-schools

So, They are, in the words of the song, making plans for Nigel.....

A few random observations.

With the British govt having poured huge amounts of taxpayer money into the salivating snout of Big Pharma, it's now being suggested that a good way of justifying this outrage would be to immunize a captive group: school kids.

Efficacy testing of the vaccine will be minimal before immunization.

Medium and long-term safety testing will be entirely absent.

If the virus mutates, the current vaccine will be entirely useless.

Unless there's something They're not telling us, swine flu has killed only a handful of people who did not have major pre-existing medical conditions.

Preliminary conclusion: vaccinating 8.5 million schoolchildren would serve no proper public health purpose and expose an entire generation to unknown and unknowable risks.

Even on The Man's favourite Risk-Benefit Analysis, the potential risk clearly outweighs the potential benefit.

Message to TPTB: (in the words of another song) Go Straight To Hell.
"It means this War was never political at all, the politics was all theatre, all just to keep the people distracted...."
"Proverbs for Paranoids 4: You hide, They seek."
"They are in Love. Fuck the War."

Gravity's Rainbow, Thomas Pynchon

"Ccollanan Pachacamac ricuy auccacunac yahuarniy hichascancuta."
The last words of the last Inka, Tupac Amaru, led to the gallows by men of god & dogs of war
Reply
#74
It's just amazing, they just want to kill us all and appear to want us to know in advance and that there isn't a thing we can do. I think this is what is meant by "hell on earth".
Dawn
Reply
#75
Dawn Meredith Wrote:It's just amazing, they just want to kill us all and appear to want us to know in advance and that there isn't a thing we can do. I think this is what is meant by "hell on earth".
Dawn

It is the stinking, rotting arrogance of it all. Closely related, is it?, to what has been said about the incredible boldness and designed psychic numbing inherent in gunning down JFK in the sunlight of Dealey Plaza, or the open "live on network TV" events of 9/11, or the open temerity of dozens of lesser events. They know we know and they wants us to know that we know they know, and they think there isn't anything that anyone can do about it.
"Where is the intersection between the world's deep hunger and your deep gladness?"
Reply
#76
Sun, August 9, 2009

Pneumonic plague has killed three during a recent outbreak which began at the end of July in Ziketan, North West China. Pneumonic plague is extremely rare, but is the most deadly type of plague. Since the start of the outbreak, nine additional human infections with Yersinia pestis, the bacteria which causes plague, have been confirmed in this Tibetan Area of Qinghai Province. The threat of disease spread was considered serious enough that the Chinese authorities took aggressive measures to keep 10,000 inhabitants of Qinghai province under quarantine. Media reports suggest that these restrictions have now been lifted.

Let’s be clear that this outbreak represents neither a disease pandemic nor an epidemic, so perhaps it may not ‘warrant’ top headline status. Annually, between 1,000 and 3,000 human Y. pestis infections are reported to the World Health Organisation (WHO) 1. News of the current outbreak has largely been relegated to short paragraphs in world news sections for any number of reasons. Limited access to information about this outbreak in this remote Chinese province may provide some explanation for the lack of media attention, as may the limited number of cases, the relative frequency of similar small plague outbreaks and the existing public health media focus on the swine flu pandemic.

Y. pestis has adapted to exist in rodents with various degrees of symptomatic illness; in some rodent hosts the bacteria can circulate without any ill-effect. As such, animals including rats, mice, ground squirrels, chipmunks and marmots can act as a reservoir for the bacteria across the globe. Transmission between these animals and to human hosts generally occurs via the bite of Y. pestis infected male and female fleas. The primary flea vector is the oriental rat flea (Xenopsylla cheopis). Transmission can also occur by handling or skinning infected animals, or by inhaling infected droplets from the cough of a pneumonic plague infected individual 1 2. Media reports suggest that the first fatal human case in the Qinghai outbreak may have resulted from handling a dead Y. pestis infected dog which had eaten an infected marmot.
plague-cycles1-300x209 Quarantine: Pneumonic Plague Outbreak in China

Plague Cycles (Neal R. Chamberlain 2003)

There are three types of disease caused by infection with the Y. pestis bacterium: bubonic, septicaemic and pneumonic plague. Bubonic and septicaemic plagues can have high mortality rates (up to 60%) without treatment; pneumonic plague has 100% mortality in the absence of treatment 3. Bubonic plague is characterized by high fever and infection of the lymph nodes; here bacteria multiply to result in characteristic enlarged, tender and necrotic glands. Septicaemic plague is rarer than bubonic plague, and occurs when the bacteria circulate in the blood rather than localizing in the lymph nodes. Bubonic and septicemic plagues can only be transmitted after direct contact with infected fluid from the lymph nodes (bubonic) or infected blood (septicaemic), so person-to-person transmission generally does not occur. Pneumonic plague is characterized by infiltration of bacteria to the lung, followed by pneumonia with coughing and dispersal of respiratory droplets in the air. Person-to-person transmission can occur via airborne bacteria after close physical contact with pneumonic plague sufferers 3-5.

Upon hearing of the Chinese plague outbreak, I was reminded of my medieval history lessons at school. I wondered about the relationship between the current outbreak and the ‘black death’ plague of the middle ages. Modern day plague outbreaks do not even begin to approach the scope of those of the 14th century ‘black death’, which is widely considered to have resulted from a bubonic plague pandemic caused by infection with Y. pestis. The ‘black death’ affected people in both urban and rural areas without discrimination. Populations were decimated to the extent that 25 million deaths are estimated to have occurred, wiping out a third of Europe’s population. If indeed Y. pestis was the primary pathogen, the 14th century pandemic most likely included sufferers with all 3 types of plague. It has also been suggested that The Justinian plague of 600AD may have resulted from Y. pestis infection 4.
world-distribution-of-plague1 Quarantine: Pneumonic Plague Outbreak in China

(CDC; Reviewed 2005)

In recent years, African countries have accounted for around 90% of plague cases reported to the WHO, but outbreaks have occurred across the globe. One recent plague outbreak occurred in Northwestern Uganda in 2006. Here 127 plague cases were confirmed, 102 patients had documented symptoms; 90 had bubonic, and 12 had pneumonic plague. There were 11 pneumonic plague deaths during this outbreak, but overall mortality rates were much lower at 22%. During this Ugandan outbreak there were reports of dead black rats (Rattus rattus). Half of the recovered dead rats were infected with Y. pestis, live rats caught within infected villages had an average of 2 fleas. The flea bite transmits the bacteria from the rodent to the human host, so multiple fleas on infected rodents increase the risk of transmission 6. Small numbers (2-17) of plague cases are reported annually in the USA 7 and recent outbreaks of plague have also occurred in Algeria (2002), India (2002) and the Democratic Republic of Congo (DRC) 8. The ongoing humanitarian crisis in DRC has meant that ‘all efforts at controlling plague have stopped’; since 2001, around 1000 suspected plague cases have been reported annually from DRC 9.

Y. pestis is considered a high risk pathogen and a potential biological weapon. The bacteria can be transmitted via aerosol with 100% mortality rates in humans in the absence of treatment (e.g. pneumonic plague). In addition, as symptoms of pneumonic plague may not be evident for up to 6 days after infection with Y. pestis, this could possibly allow dispersal of the pathogen to a large population before antibiotic intervention occurs 5. However, the bacteria remain infectious as airborne pathogens for less than one hour and can only spread within a few metres from the pneumonic plague sufferer; these factors may limit the potential for Y. pestis transmission to large populations 3-5.

While all this plague outbreak talk may seem quite frightening, outbreaks of plague are extremely rare, even in the least developed countries of the world. Where outbreaks do occur, disease containment is usually swift and certain. Plague deaths are rare and antibiotics can effectively treat the disease, especially when it’s identified early. Biomedical research is also underway globally to further study the genetic and virulence characteristics of Y. pestis, as well as to develop fast acting vaccines against the bacteria. For your own sanity please don’t have nightmares about modern day plague scenarios! Despite existing reservoirs for the Y. pestis bacteria in some wild rodent populations, the risk of plague epidemics or pandemics is miniscule.

1. CDC. Plague Fact Sheet. 2005; http://www.cdc.gov/ncidod/dvbid/plague/r...tSheet.pdf

2. CDC. Protect yourself from plague. http://www.cdc.gov/ncidod/dvbid/plague/r...ochure.pdf

3. Butler T. Plague into the 21st century. Clin Infect Dis 2009; 49 (5) 736-42 http://www.journals.uchicago.edu/doi/pdf/10.1086/604718

4. Crawford D. Deadly Companions: How Microbes Shaped Our History. 2007; Chapter 4 85-106 http://www.amazon.co.uk/gp/reader/019280...eader-link

5. CDC. Frequently asked questions about the plague. 2005; http://www.bt.cdc.gov/agent/plague/faq.asp

6. CDC. Bubonic and pneumonic plague - Uganda, 2006. MMWR Morb Mortal Wkly Rep 2009; 58 (28) 778-81 http://www.cdc.gov/mmwr/preview/mmwrhtml/mm5828a3.htm

7. CDC. Notifiable Diseases/Deaths in Selected Cities Weekly Information. MMWR Morb Mortal Wkly Rep 2009; 58 (29) 808-819 http://www.cdc.gov/mmwr/preview/mmwrhtml/mm5829md.htm

8. WHO. Global Alert and Response (GAR): Plague. http://www.who.int/csr/don/archive/disea...index.html

9. CDC. Plague: Enhancing country readiness. 2009; http://www.who.int/csr/disease/plague/re...index.html

More on these topics:

Airborne, Algeria, Bacteria, Bio-weapon, Black death, Black rat, Bubonic plague, China, Democratic Republic of Congo, Flea, India, Justinian plague, Plague, Pneumonic plague, Qinghai Province, Quarantine, Rattus rattus, Rodent, Septicaemic plague, Uganda, USA, Xenopsylla cheopis, Yersinia pestis, Ziketan



http://thefastertimes.com/globalpandemic...-in-china/
"Where is the intersection between the world's deep hunger and your deep gladness?"
Reply
#77
See also:


http://www.new-fields.com/ISFC/brochure.pdf

a six-page brochure for the International Swine Flu Conference in Washington on August 19-21, 2009
Hyatt Regency Washington on Capitol Hill
400 New Jersey Avenue, NW, Washington, D.C., USA 20001


related article:
http://www.globalresearch.ca/index.php?c...&aid=14705
"Where is the intersection between the world's deep hunger and your deep gladness?"
Reply
#78
Biological Warfare and the National Security State
A Chronology

by Tom Burghardt

[Image: 14708.jpg]. Global Research, August 9, 2009
Antifascist Calling...

[Image: emailfriend.gif] Email this article to a friend
[Image: printfriendly.gif] Print this article



[Image: 32x32_su_round.gif]
The history of bioweapons research in the United States is a history of illicit--and illegal--human experiments.
From the Cold War to the War on Terror, successive American administrations have turned a blind eye on dubious research rightly characterized as having "a little of the Buchenwald touch."
While the phrase may have come from the files of the Atomic Energy Commission as Pulitzer prize-winning journalist Eileen Welsome revealed in her 1999 book, The Plutonium Files, an investigation into secret American medical experiments at the dawn of the nuclear age, it is as relevant today as the United States pours billions of dollars into work on some of the most dangerous pathogens known to exist in nature.
That Cold War securocrats were more than a little concerned with a comparison to unethical Nazi experiments is hardly surprising. After all, with the defeat of the Axis powers came the triumphalist myth-making that America had fought a "good war" and had liberated humanity from the scourge of fascist barbarism.
Never mind that many of America's leading corporations, from General Motors to IBM and from Standard Oil to Chase National Bank, were sympathizers and active collaborators with the Third Reich prior to and even during World War II, as documented by investigative journalists Charles Higham in Trading With The Enemy, and Edwin Black in IBM and the Holocaust. Like much else in American history, these were dirty little secrets best left alone.
Soon enough however, these erstwhile democrats would come to view themselves as mandarins of a new, expanding American Empire for whom everything was permitted. In this context, the recruitment of top German and Japanese scientists who had conducted grisly "medical" experiments whilst waging biological war against China and the Soviet Union would be free of any moralizing or political wavering.
As the Cold War grew hotter and hotter, America's political leadership viewed "former" Nazis and the architects of Japan's Imperial project not as war criminals but allies in a new undertaking: the global roll-back of socialism and the destruction of the Soviet Union by any means necessary.
This tradition is alive and well in 21st century America. With the September 11, 2001 terrorist attacks and subsequent anthrax mailings as a pretext for an aggressive militarist posture, the national security state is ramping-up research for the production of genetically-modified organisms for deployment as new, frightening weapons of war.
According to congressional testimony by Dr. Alan M. Pearson, Director of the Biological and Chemical Weapons Control Program at the Washington D.C.-based Center for Arms Control and Non-Proliferation, with very little in the way of effective oversight or accountability, tens of billions of dollars "have been appropriated for bioweapons-related research and development activities." Pearson reveals that approximately $1.7 billion "has been appropriated for the construction on new high containment facilities for bioweapons-related research."
By high containment facilities I mean facilities that are designed for work with agents that may cause serious or potentially lethal disease through exposure to aerosols (called Biosafety Level 3 or BSL-3 facilities) and facilities that are designed for work with agents that pose a "high individual risk of life-threatening disease, which may be transmitted via the aerosol route and for which there is no available vaccine or therapy" (called Biosafety Level 4 or BSL-4 facilities).
Prior to 2002, there were three significant BSL-4 facilities in the United States. Today twelve are in operation, under construction, or in the planning stage. When completed, there will be in excess of 150,000 square feet of BSL-4 laboratory space (as much space as three football fields). The number of BSL-3 labs is also clearly growing, but ascertaining the amount of growth is difficult in the absence of accurate baseline information. There are at least 600 such facilities in the US. (Alan M. Pearson, Testimony, "Germs, Viruses, and Secrets: The Silent Proliferation of Bio-Laboratories in the United States," House Energy and Commerce Committee, Subcommittee on Oversight and Investigations, October 2007)
Chillingly, one consequence of this metastatic growth "is that the very labs designed to protect against bioweapons may become a source for them." As the 2001 anthrax attacks amply demonstrated, the threat posed by a biological weapons' incident may be closer to home than any of us care to think. Pearson writes, "Nor should we ignore the possibility that a US biologist may become disgruntled or turn rogue while working in one of these labs."
According to Edward Hammond, the Director of the now-defunct Sunshine Project, while "biological arms control is currently in ... its worst crisis since the signing of the Bioweapons Convention (BWC) in 1972," the American Bioweapons-Industrial Complex has "embarked on the exploitation of biotechnology for weapons development." Indeed, Hammond relates that active programs utilizing genetic engineering techniques have "been employed in offensive biowarfare programs in order to make biowarfare agents more effective."
But increases in state subsidies for such work have generated new risks to the public. A recent Government Accountability Office (GAO) report faulted the Centers for Disease Control and Prevention (CDC) for lax security at three of the nation's five BSL-4 labs currently in operation that "handle the world's most dangerous agents and toxins that cause incurable and deadly diseases." Agents such as Ebola, Marburg and smallpox are routinely studied at these facilities. And yet, as GAO auditors found,
Select agent regulations do not mandate that specific perimeter security controls be present at BSL-4 labs, resulting in a significant difference in perimeter security between the nation's five labs. According to the regulations, each lab must implement a security plan that is sufficient to safeguard select agents against unauthorized access, theft, loss, or release. However, there are no specific perimeter security controls that must be in place at every BSL-4 lab. While three labs had all or nearly all of the key security controls we assessed, our September 2008 report demonstrated that two labs had a significant lack of these controls. (Government Accountability Office, Biosafety Laboratories: BSL-4 Laboratories Improved Perimeter Security Despite Limited Action by CDC, GAO-09-851, July 2009)
As Global Security Newswire revealed in June, a "recently completed inventory at a major U.S. Army biodefense facility found nearly 10,000 more vials of potentially lethal pathogens than were known to be stored at the site."
The 9,220 samples--which included the bacterial agents that cause plague, anthrax and tularemia; Venezuelan, Eastern and Western equine encephalitis viruses; Rift valley fever virus; Junin virus; Ebola virus; and botulinum neurotoxins--were found during a four-month inventory at the U.S. Army Medical Research Institute of Infectious Diseases at Fort Detrick, Md., according to Col. Mark Kortepeter, the center's deputy commander. (Martin Matishak, "Thousands of Uncounted Disease Samples Found at Army Biodefense Lab," Global Security Newswire, June 18, 2009)
The GSN report states that while "half of the newfound material was destroyed after being recorded," inventory control officer Sam Edwin told reporters that "the other half was deemed worthy for further scientific use, cataloged, and stored in the center's containment freezers."
More pertinently, what happens when the state itself turns "rogue" and under cover of national security and the endless "war on terror" creates the "acute risk" in the form of out-of-control laboratories "designed to protect against bioweapons" that instead, have "become a source for them"?
Bioweapons and National Security: A Chronology
Source Notes: This chronology has drawn from dozens of books, articles and declassified government documents in its preparation. Notable in this regard is Michael Christopher Carroll's Lab 257: The Disturbing Story of the Government's Secret Germ Laboratory; Linda Hunt, Secret Agenda; Bob Coen and Eric Nadler, Dead Silence: Fear and Terror on the Anthrax Trail; the National Security Archive's documentary history of U.S. Biological Warfare programs and The Sunshine Project.
* August 1945: Operation Paperclip, an Office of Strategic Services (OSS) program to import top Nazi scientists into the United States. Linda Hunt relates in her book, Secret Agenda, that Reich Health Leader (Reichsgesundheitsführer) Dr. Kurt Blome, was saved from the gallows due to American intervention. Blome admitted he had worked on Nazi bacteriological warfare projects and had experimented on concentration camp prisoners with bubonic plague and sarin gas at Auschwitz. After his acquittal at the 1947 Nuremberg Doctors' Trial, Blome was recruited by the U.S. Army Chemical Corps and advised the Pentagon on biological warfare. Walter Paul Emil Schreiber, a Wehrmacht general who assigned doctors to experiment on concentration camp prisoners and disbursed state funds for such experiments was another Paperclip recruit; in 1951, Schreiber went to work for the U.S. Air Force School of Medicine. Hubertus Strughold, the so-called "father of space medicine" discussed--and carried out--experiments on Dachau inmates who were tortured and killed; Strughold worked for the U.S. Air Force. Erich Traub, a rabid Nazi and the former chief of Heinrich Himmler's Insel Riems, the Nazi state's secret biological warfare research facility defects to the United States. Traub was brought to the U.S. by Paperclip operatives and worked at the Naval Medical Research Institute and gave "operational advice" to the CIA and the biowarriors at Ft. Detrick.
* September 1945: General Shiro Ishii's Unit 731, a secret research group that organized Japan's chemical and biological warfare programs is granted "amnesty" by Supreme Allied Commander in the Pacific, General Douglas MacArthur in exchange for providing America with their voluminous files on biological warfare. All mention of Unit 731 is expunged from the record of The Tokyo War Crimes Tribunal. During the war, Unit 731 conducted grisly experiments, including the vivisection of live prisoners, and carried out germ attacks on Chinese civilians and prisoners of war. According to researcher Sheldon H. Harris in Factories of Death: Japanese Biological Warfare 1932-45 and the American Cover-Up, Unit 731 scientists performed tests on prisoners with plague, cholera, smallpox, botulism and other infectious diseases. Their work led to the development of what was called a defoliation bacilli bomb and a flea bomb used by the Imperial Army to spread bubonic plague across unoccupied areas of China. The deployment of these lethal munitions provided the Imperial Army with the ability to launch devastating biological attacks, infecting agriculture, reservoirs, wells and populated areas with anthrax, plague-infected fleas, typhoid, dysentery and cholera. Rather than being prosecuted as war criminals, Unit 731 alumni became top bioweapons researchers. Ishii himself became an adviser at USAMRIID at Ft. Detrick.
1950: A U.S. Navy ship equipped with spray devices supplied by Ft. Detrick, sprayed serratia marcescens across the San Francisco Bay Area while the ship plied Bay waters. Supposedly a non-pathogenic microorganism, twelve mostly elderly victims die.
* Early 1950s: Army biological weapons research begins at the Plum Island Animal Disease Center (PIADC). Vials of anthrax are transferred from Ft. Detrick to Plum Island. This information is contained in a now declassified report, "Biological Warfare Operations," Research and Development Annual Technical Progress Report, Department of the Army, 1951.
* 1951: Racist experiments are carried out. U.S. Army researchers deliberately expose African-Americans to the fungus Aspergillus fumigatus to discern whether they are more susceptible to infections caused by such organisms than white Europeans. Also in 1951, black workers at the Norfolk Supply Center in Virginia were exposed to crates contaminated with A. fumigatus spores.
* 1952: According to 1977 hearings by the Senate Select Committee on Intelligence and the Subcommittee on Health and Scientific Research into Project MKULTRA, we discover the following: "Under an agreement reached with the Army in 1952, the Special Operations Division (SOD) at Fort Detrick was to assist CIA in developing, testing, and maintaining biological agents and delivery systems. By this agreement, CIA acquired the knowledge, skill, and facilities of the Army to develop biological weapons suited for CIA use."
* 1953: Frank Olson, a chemist with the Army's top secret Special Operations Division at Ft. Detrick was involved with biological weapons research and was tasked to the CIA for work on MKULTRA. In 1953, as Deputy Acting Head of Special Operations for the CIA, Olson is a close associate of psychiatrist William Sargant who was investigating the use of psychoactive drugs as an interrogation tool at Britain's Biological Warfare Centre at Porton Down. After being dosed with LSD without his knowledge by Dr. Sidney Gottlieb, the Agency's liaison to Ft. Detrick, Olson undergoes a severe psychological crisis. The scientist begins questioning the ethics of designing biological organisms as weapons of war. This does not sit well with his Agency and Army superiors. On November 24, 1953, Olson and a CIA minder, Robert Lashbrook, check into New York's Staler Hotel. He never checked out. According to Lashbrook, Olson had thrown himself through the closed shade and window, plunging 170 feet to his death. But because of his knowledge of CIA "terminal experiments" and other horrors conducted under MKULTRA, the Olson family believes the researcher was murdered. When Olson's son Eric has his father's body exhumed in 1994, the forensic scientist in charge of the examination determines that Olson had suffered blunt force trauma to the head prior to his fall through the window; the evidence is called "rankly and starkly suggestive of homicide." Norman G. Cournoyer, one of Olson's closet friends at Ft. Detrick also believes the scientist was murdered. When asked by the Baltimore Sun in 2004 why Olson was killed, Cournoyer said, "To shut him up. ... He wasn't sure we should be in germ warfare, at the end."
* 1955: Following a CIA biowarfare test in Tampa Bay, Florida, the area experiences a sharp rise in cases of Whooping Cough, including 12 deaths. The Agency had released bacteria it had obtained from the U.S. Army's Chemical and Biological Warfare Center at the Dugway Proving Grounds.
* 1956-1958: More racist experiments. The U.S. Army conducted live field tests on poor African-American communities in Savannah, Georgia and Avon Park, Florida. Mosquitoes were released into neighborhoods at ground level by "researchers" or by helicopter; residents were swarmed by the pest; many developed unknown illnesses and some even died. After the tests, Army personnel posing as health workers photographed and tested the victims, then disappeared. While specific details of the experiments remain classified, it has been theorized that a strain of Yellow Fever was used to test its efficacy as a bioweapon.
* 1962: A declassified CIA document obtained by the National Security Archive relates the following: "In November 1962 Mr. [redacted] advised Mr. Lyman Kirkpatrick that he had, at one time, been directed by Mr. Richard Bissell to assume responsibility for a project involving the assassination of Patrice Lumumba, then Premier, Republic of Congo. According to Mr. [redacted] poison was to have been the vehicle as he made reference to having been instructed to see Dr. Sidney Gottlieb in order to procure the appropriate vehicle." Gottlieb was the chief scientific adviser for the CIA's MKULTRA program.
* June 1966: The U.S. Army's Special Operations Division dispenses Bacillus subtilis var niger throughout the New York City subway system. More than a million people were exposed when Army operatives dropped light bulbs filled with the bacteria onto ventilation grates.
* December, 1967: The New York Times reports, "Fatal Virus Found in Wild Ducks on L.I." A virus never seen before in the Western hemisphere, began with ducks in Long Island at a site opposite Plum Island; the virus devastates the area's duck industry and by 1975 has spread across the entire continent.
* 1971: The U.S. Department of Agriculture proclaims that "Plum Island is considered the safest in the world on virus diseases." USDA's proof? "There has never been a disease outbreak among the susceptible animals maintained outside the laboratory since it was established."
* 1975: PIADC begins feeding live viruses to "hard ticks," including the Lone Star tick (never seen outside Texas prior to 1975). The Lone Star tick is a carrier of the Borelia burgdorferi (Bb) bacteria, the causal agent of Lyme Disease. The first cases of the illness are reported in Connecticut, directly across from the facility. Current epidemiological data conclusively demonstrate that the epicenter of all U.S. Lyme Disease cases is Plum Island. It is theorized that deer bitten by infected ticks swam across the narrow waterway separating the island from the mainland.
* September 1978: A PIADC news release relays the following: "Foot and Mouth Disease has been diagnosed in cattle in a pre-experimental animal holding facility at the Plum Island Animal Disease Center." A documented outbreak has occurred.
* 1979: An internal investigation of the FMD incident reveals massive, widespread failures in the containment systems at PIADC. A USDA Committee report recommends that "Lab 101 not be considered as a safe facility in which to do work on exotic disease agents until corrective action is accomplished."
* 1979: Despite containment failures and poor practices, USAMRIID undertakes the investigation of the deadly Zagazig 501 strain of Rift Valley Fever at PIADC. Producing symptoms similar to aerosolized hemorrhagic fevers such as Marburg and Ebola virus, the Army inoculates sheep that should have been destroyed as a result of the FMD outbreak with an experimental Rift Valley Fever vaccine. The experiments are conducted outdoors, in violation of the lab's primary directive prohibiting such work. During a 1977 Rift Valley outbreak in Egypt, some 200,000 people are infected and 700 others die excruciating deaths. A survey of blood serum taken before 1977 proved that the virus was not present in Egypt prior to the epidemic. By 2000, rampant outbreaks of the disease have occurred in Saudi Arabia and Yemen with the virus poised to unfurl its tentacles into Europe.
* 1982: A Federal review begun after the FMD outbreak concludes: "We believe there is a potentially dangerous situation and that without an immediate massive effort to correct deficiencies, a severe accident could result... [L]ack of preventive maintenance, [and] pressures by management to expedite programs have resulted in compromising safety."
* 1983: Six PIADC workers test positive for African Swine Fever virus. The workers are not notified of the test results which are conducted clandestinely during routine annual physical exams.
* 1991: USDA privatizes PIADC. A New Jersey firm, Burns & Roe Services Corporation low bids other competitors and is awarded the contract. In cost-cutting moves, the contractor scales back on safety and security measures in place for decades.
* June 1991: An underground cable supplying Lab 257 shorts out but is not replaced since there is no money left in the budget.
* August 1991: Hurricane Bob, a category 3 storm similar to Hurricane Katrina, slams into Plum Island, knocking down overhead power lines that connect Lab 257. The underground cable which was Lab 257's primary power source has not been repaired. Freezers containing virus samples defrost, air seals on lab doors are breached and animal holding room vents fail. PIADC's "fail safe" mechanism of "air dampers" to seal off the facility also fail. Melted virus samples mix with infected animal waste on lab floors as swarms of mosquitoes fill the facility.
* September 1991: The USDA denies that any system failures occurred during the hurricane. Whistleblowing workers in Lab 257 at the time of the blackout are fired in further cost-cutting moves and several subsequently develop mysterious undiagnosed diseases.
* 1992: The Occupational Safety and Health Administration (OSHA) and the Environmental Protection Agency (EPA) cite PIADC with hundreds of safety violations. When OSHA returned five years later, none of the violations have been corrected and discover 124 new violations.
* July 1992: Although USDA officially denies that PIADC conducts biological warfare research, fourteen officials from the Joint Chiefs of Staff and the Pentagon visit Plum Island. Internal documents reveal that that the visit was "to meet with [Plum Island] staff regarding biological warfare." According to Carroll, "the visitors were part of the Arms Control and Disarmament Agency reviewing the dual-use capabilities of the facility."
* Spring 1995: Lab 257 is closed. Although scheduled to be fully decontaminated and demolished in 1996 Carroll reports: "Lab 257 still stands today, rotting from weathered decay, harboring who knows what deep within."
* August 1999: The first four human cases of West Vile virus, a mosquito-borne pathogen never diagnosed in North America are diagnosed on Long Island. Horse farms within a five-mile radius of one another, directly opposite Plum Island, report horses dying following violent seizures. An investigation reveals that 25% of the horses in this small, localized area test positive for West Nile. The outbreak begins in August 1999 when birds, including half the exotic bird species in the Bronx Zoo begin dying mysteriously. The virus has an affinity for birds and the vector is soon identified as the mosquito. In 1999, the disease was confined to the New York City area, however by 2002, the Centers for Disease Control reports all but 6 of the lower 48 states reported West Nile virus in birds, mosquitos, animals or human populations. CDC estimates that some 200,000 people are infected nationally. During the initial outbreak in 1999, veterinary pathologist Tracey McNamara suspected a casual relationship between the bird die-offs and the human cases; CDC rebuffs her concerns. Through her persistent efforts, it is determined that the virus was indeed West Nile, a pathogen that had never been seen in North America. The CDC announces that West Nile virus was in the nation's blood supply when transplant patients who had no prior exposure to the pathogen develop the disease. The USDA's response? Deny, deny, deny? However, Jim House, a former PIADC scientist, believes that West Nile samples existed prior to 1999 on Plum Island. He told Carroll, "There were samples there, and it wasn't answered clearly to the public. They didn't honestly tell how many samples they had and that's when people started to get upset. When Carroll filed a Freedom of Information Act request for a catalog of germs held in the Plum Island virus library, he was turned down on grounds of "national security."
* September 1999: The New York Times reports that due to "the growing threat of biological terrorism" against America's food supply, USDA "is seeking money to turn the Plum Island Animal Disease Center ... into a top security laboratory where some of the most dangerous diseases known to man or beast can be studied."
* 1999: A Cold War-era document is declassified proving that in the early 1950s USAMRIID shipped twelve vials of weaponized anthrax (enough to kill one million people) to PIADC. In 1993 Newsday revealed that previously unclassified documents demonstrated Pentagon plans to disrupt the Soviet economy by spreading diseases to kill pigs, cattle and horses.
* 1999: Plans to "upgrade" PIADC by building a BSL-4 lab are killed when Congress pulls funding after a public outcry.
* September 2001: After the anthrax attacks, despite USDA denials that anthrax was ever present on the island, FBI investigators include the following questions in their polygraph examination of scientists under investigation: "Have you ever been to Plum Island?" "Do you know anyone who works at Plum Island?" "What do they do there?"
* December 2002: The New York Times reports "a three-hour power failure at the Plum Island Animal Disease Center last weekend renewed concerns about the safety of the high-security government laboratory." According to the Times, "the loss of power and failure of all three backup generators raised fears for the first time that the containment of infectious pathogens could have been seriously compromised at the laboratory."
* June 2003: President George W. Bush transfers control of PIADC to the Department of Homeland Security. The airspace over the island is unrestricted and the gates leading to Lab 101 remain open and unguarded.
* May 2004: In a sign that work on Plum Island is being shifted to "other sites," including those run by private contractors, DHS announces an $18 million grant to study Rift Valley fever, avian influenza and brucellosis.
* August 2004: DHS confirmed that an FMD outbreak "had spread briefly" in "two previously undisclosed incidents earlier this summer," The New York Times reports. A DHS spokesperson said the virus remained "within the laboratory's sealed biocontainment area" and that there "had be no risk" to human or animals. An investigation into the cause "was continuing."
* 2004: At the Medical University of Ohio, a researcher is infected with Valley Fever at the center's BSL-3 facility; Valley Fever is a biological weapons agent.
* February 2005: University of Iowa researchers conduct unauthorized genetic engineering experiments with the select agent Tularemia (rabbit fever). The Sunshine Project reports that researchers mixed genes from Tularemia species and introduced antibiotic resistant characteristics into the samples.
* March 2005: When a containment facility fails, workers at the University of North Carolina at Chapel Hill are exposed to tuberculosis when the BSL-3 "fail-safe" systems malfunction; a blower pushes contaminated air out of the work cabinet, infecting the workroom. The facility had been inspected one month prior to the accident by U.S. Army.
* Summer 2005: At the same Ohio facility a serious accident occurs when workers are infected with an aerosol of Valley Fever.
* October-November 2005: Dozens of samples thought to be harmless are received by the University of California at Berkeley. In fact, they are samples of Rocky Mountain Spotted Fever, a BSL-3 bioweapons agent due to its transmission as an aerosol. The samples are handled without adequate safety precautions; however, the community is never notified of the incident.
* August 2005: The whistleblowing watchdog group Tri-Valley Cares obtains documents in May 2009 proving that the Lawrence Livermore National Laboratory had conducted "restricted experiments" with "select biological agents" at the facility. In 2005, LLNL "inadvertently" released anthrax at the lab in another incident that lab officials attempted to cover-up; five individuals were infected with the deadly pathogen.
* April 2006: Three Texas A&M "biodefense" researchers are infected with Q Fever, a biological weapons agent. Rather than reporting the incident to the CDC as required by law, Texas A&M officials cover-up the accident.
* August 2006: DHS announces that PIADC is "not on the rebuilding list" and a new site to study infectious diseases is being considered.
* January 2009: DHS announces that the new National Bio and Agro-Defense Facility will be built in Manhattan, Kansas.
* July 2009: Government Accountability Office investigators charge that DHS relied on "a rushed, flawed study" to locate the $700 million research facility for highly infectious pathogens "in a tornado-prone section of Kansas." Among other concerns, the GAO cites DHS's "flawed and outdated methodology" in its criticism. Those concerns are: "the ability of DHS and the federal government in general to safely operate a biosafety facility such as the proposed NBAF; the potential for a pathogenic release through accidents, natural phenomena, and terrorist actions; our May 2008 testimony that concluded that DHS had not conducted or commissioned a study to determine whether FMD research could be conducted safely on the U.S. mainland; natural phenomena such as tornadoes, earthquakes, and hurricanes that could cause catastrophic damage to the NBAF and result in the release of a pathogen; the possibility that an infected mosquito vector could escape, allowing a pathogen such as Rift Valley Fever virus to become permanently established in the United States; the economic effects of a release or a perceived release on the local, state, and national livestock industry."
Tom Burghardt is a researcher and activist based in the San Francisco Bay Area. In addition to publishing in Covert Action Quarterly and Global Research, his articles can be read on Dissident Voice, The Intelligence Daily, Pacific Free Press and the whistleblowing website Wikileaks. He is the editor of Police State America: U.S. Military "Civil Disturbance" Planning, distributed by AK Press.



http://www.globalresearch.ca/index.php?c...&aid=14708
"Where is the intersection between the world's deep hunger and your deep gladness?"
Reply
#79
http://www.legitgov.org/baxter_vaccine_oddities.html
Reply
#80
FEMA Awards Contract to PaTH Joint Venture of DynCorp International, Dewberry and Parsons

[Image: Bus_20090710160728_19.jpg]
Posted : Fri, 10 Jul 2009 14:06:29 GMT Author : DynCorp International Category : Press Release News Alerts by Email ( click here ) Press Release News | Home


FALLS CHURCH, Va. - (Business Wire) The Federal Emergency Management Agency (FEMA) has awarded a contract to Partnership for Temporary Housing, LLC (PaTH) to provide temporary housing and support for shelter operations for disaster victims. The indefinite delivery/indefinite quantity Individual Assistance-Technical Assistance Contract III (IA-TAC III), has a potential value of $375 million over the one-year base period and four one-year option periods. PaTH is a limited liability corporation formed by DynCorp International LLC, Dewberry, and Parsons Corporation. PaTH provides responsive, cost-effective temporary housing services and mass care solutions to disaster victims on behalf of the Department of Homeland Security’s FEMA. In 2008, PaTH assisted flood victims in Iowa with the provision of temporary shelter, under its IA-TAC II contract.

Under the IA-TAC III contract, the PaTH joint venture is responsible for work in the western continental U.S., as well as Alaska, Hawaii, Guam and American Samoa. The primary work to be performed under task orders is expected to include the provision of temporary housing and support to shelter operations in the assigned sector.

About DynCorp International
DynCorp International (NYSE-CP) is a provider of specialized mission-critical services to civilian and military government agencies worldwide, and operates major programs in law enforcement training and support, security services, base operations, aviation services, contingency operations, and logistics support. DynCorp International is headquartered in Falls Church, Va. For more information, visit www.dyn-intl.com.

About Dewberry
For a half-century, Dewberry® has been a leader in the planning, design, and program management professions. We work in partnership with public- and private-sector clients locally, regionally, and nationally. Our multi-disciplinary staff includes engineers, architects, planners, surveyors, environmental scientists, and many specialized experts. Dewberry offers clients an integrated service approach with a commitment to value and performance. Established in 1956, Dewberry is headquartered in Fairfax, Va. For more information, visit www.dewberry.com.

About Parsons
Parsons is a leader in many diverse markets such as infrastructure, transportation, water, telecommunications, aviation, commercial, environmental, industrial manufacturing, education, healthcare, life sciences and homeland security. Parsons provides technical and management solutions to federal, regional and local government agencies as well as private industries worldwide. Parsons is headquartered in Pasadena, Ca. For more information, visit www.parsons.com.

DynCorp International
Douglas Ebner, 817-224-7822


http://www.earthtimes.org/articles/show/...8189.shtml
"Where is the intersection between the world's deep hunger and your deep gladness?"
Reply


Possibly Related Threads…
Thread Author Replies Views Last Post
  Ebola - The New Pandemic - Coming to someplace near you soon?! Peter Lemkin 53 41,809 31-10-2014, 12:21 AM
Last Post: R.K. Locke
  Anthrax drug death sparks fear of Europe-wide pandemic Magda Hassan 0 3,864 18-08-2012, 05:23 PM
Last Post: Magda Hassan
  Plum Island, Off Long Island - Nazi Paperclip Past; Bioweapons-DHS Present Ed Jewett 4 7,968 28-07-2012, 12:02 PM
Last Post: Peter Lemkin
  You Have Used Me as a Fish Long Enough Austin Kelley 4 7,798 23-02-2010, 11:05 PM
Last Post: Austin Kelley

Forum Jump:


Users browsing this thread: 1 Guest(s)